Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635994_at:

>probe:Drosophila_2:1635994_at:665:595; Interrogation_Position=1739; Antisense; TGTCCGTTGGCCACGACGAGGTGCT
>probe:Drosophila_2:1635994_at:189:589; Interrogation_Position=1796; Antisense; TGGTGCCGCCGGATTTCTATGACAG
>probe:Drosophila_2:1635994_at:292:683; Interrogation_Position=1813; Antisense; TATGACAGCTATACGCCAGGCGGCA
>probe:Drosophila_2:1635994_at:552:695; Interrogation_Position=1892; Antisense; TTCCCGCCTATCAGTACCAGTACAG
>probe:Drosophila_2:1635994_at:315:231; Interrogation_Position=1935; Antisense; CAAGAGTTCCGGCTCCAGTTCGGGC
>probe:Drosophila_2:1635994_at:27:651; Interrogation_Position=1968; Antisense; TCACGGTCATCATCATGGCCAGCAT
>probe:Drosophila_2:1635994_at:562:571; Interrogation_Position=2029; Antisense; GGCTCCAAGCGGGACAGCTTCAATT
>probe:Drosophila_2:1635994_at:214:343; Interrogation_Position=2045; Antisense; GCTTCAATTCGCTAAACGGCACGGA
>probe:Drosophila_2:1635994_at:426:547; Interrogation_Position=2141; Antisense; GGATGCGACGCAGCAGTCCGCGCAA
>probe:Drosophila_2:1635994_at:12:599; Interrogation_Position=2192; Antisense; TGTCCGGACGCAGCTCGATGAAGTC
>probe:Drosophila_2:1635994_at:261:445; Interrogation_Position=2208; Antisense; GATGAAGTCCTCGTCGCGGGACTAT
>probe:Drosophila_2:1635994_at:603:527; Interrogation_Position=2225; Antisense; GGGACTATGACTACGGGCACGGCTC
>probe:Drosophila_2:1635994_at:602:295; Interrogation_Position=2264; Antisense; CGCATCCGGAGCTCGATTTCAGGGA
>probe:Drosophila_2:1635994_at:231:649; Interrogation_Position=2282; Antisense; TCAGGGAGAACATCTTTGCGGAGCT

Paste this into a BLAST search page for me
TGTCCGTTGGCCACGACGAGGTGCTTGGTGCCGCCGGATTTCTATGACAGTATGACAGCTATACGCCAGGCGGCATTCCCGCCTATCAGTACCAGTACAGCAAGAGTTCCGGCTCCAGTTCGGGCTCACGGTCATCATCATGGCCAGCATGGCTCCAAGCGGGACAGCTTCAATTGCTTCAATTCGCTAAACGGCACGGAGGATGCGACGCAGCAGTCCGCGCAATGTCCGGACGCAGCTCGATGAAGTCGATGAAGTCCTCGTCGCGGGACTATGGGACTATGACTACGGGCACGGCTCCGCATCCGGAGCTCGATTTCAGGGATCAGGGAGAACATCTTTGCGGAGCT

Full Affymetrix probeset data:

Annotations for 1635994_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime