FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635996_at:

>probe:Drosophila_2:1635996_at:619:475; Interrogation_Position=1159; Antisense; GTTATTCTCTACACCGCCGAGAAAG
>probe:Drosophila_2:1635996_at:241:223; Interrogation_Position=1189; Antisense; AAGGTGGCGCTCGATGCCATTCAGA
>probe:Drosophila_2:1635996_at:615:281; Interrogation_Position=1198; Antisense; CTCGATGCCATTCAGATCCTAGGTG
>probe:Drosophila_2:1635996_at:295:447; Interrogation_Position=1212; Antisense; GATCCTAGGTGGCAATGGCTACATT
>probe:Drosophila_2:1635996_at:493:13; Interrogation_Position=1234; Antisense; ATTAACGAGAATCCCACTGGTCGCA
>probe:Drosophila_2:1635996_at:486:591; Interrogation_Position=1251; Antisense; TGGTCGCATCCTGCGAGATGCTAAA
>probe:Drosophila_2:1635996_at:118:429; Interrogation_Position=1282; Antisense; GAGATTGGCGCAGGAACCTCCGAGA
>probe:Drosophila_2:1635996_at:272:381; Interrogation_Position=1295; Antisense; GAACCTCCGAGATCAGACGCTGGCT
>probe:Drosophila_2:1635996_at:128:583; Interrogation_Position=1315; Antisense; TGGCTGATTGGTCGCCAGCTCAACC
>probe:Drosophila_2:1635996_at:9:125; Interrogation_Position=1360; Antisense; AGCGCCATCTCTTTTTCCAATGTGG
>probe:Drosophila_2:1635996_at:320:521; Interrogation_Position=1381; Antisense; GTGGCAATAACGTGGACCAACTCTA
>probe:Drosophila_2:1635996_at:257:585; Interrogation_Position=1393; Antisense; TGGACCAACTCTACTACCTGACAGA
>probe:Drosophila_2:1635996_at:371:681; Interrogation_Position=1572; Antisense; TATGCAACTGCATACACGACTCGCA
>probe:Drosophila_2:1635996_at:48:259; Interrogation_Position=1586; Antisense; CACGACTCGCACACGTACGTATATA

Paste this into a BLAST search page for me
GTTATTCTCTACACCGCCGAGAAAGAAGGTGGCGCTCGATGCCATTCAGACTCGATGCCATTCAGATCCTAGGTGGATCCTAGGTGGCAATGGCTACATTATTAACGAGAATCCCACTGGTCGCATGGTCGCATCCTGCGAGATGCTAAAGAGATTGGCGCAGGAACCTCCGAGAGAACCTCCGAGATCAGACGCTGGCTTGGCTGATTGGTCGCCAGCTCAACCAGCGCCATCTCTTTTTCCAATGTGGGTGGCAATAACGTGGACCAACTCTATGGACCAACTCTACTACCTGACAGATATGCAACTGCATACACGACTCGCACACGACTCGCACACGTACGTATATA

Full Affymetrix probeset data:

Annotations for 1635996_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720