FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635998_at:

>probe:Drosophila_2:1635998_at:534:449; Interrogation_Position=468; Antisense; GATCGTACAAGTATGTCCAACCACA
>probe:Drosophila_2:1635998_at:602:199; Interrogation_Position=486; Antisense; AACCACATGGCCGTGACTTTGTGGC
>probe:Drosophila_2:1635998_at:639:691; Interrogation_Position=503; Antisense; TTTGTGGCCAACTATTATGCTGATA
>probe:Drosophila_2:1635998_at:209:455; Interrogation_Position=524; Antisense; GATAAGACCGGTTTCCATGTGGAGG
>probe:Drosophila_2:1635998_at:645:595; Interrogation_Position=541; Antisense; TGTGGAGGACAATCGTCCGGCACAC
>probe:Drosophila_2:1635998_at:356:663; Interrogation_Position=568; Antisense; TAAACTGCCGGCCACTAAGACTCCG
>probe:Drosophila_2:1635998_at:155:705; Interrogation_Position=670; Antisense; TTATGCCGCCGAGTACCAGCAGGAG
>probe:Drosophila_2:1635998_at:206:487; Interrogation_Position=682; Antisense; GTACCAGCAGGAGGGTCGCTACCAG
>probe:Drosophila_2:1635998_at:245:431; Interrogation_Position=719; Antisense; GAGTACCAGCCCTACGTGCACGAGG
>probe:Drosophila_2:1635998_at:44:141; Interrogation_Position=732; Antisense; ACGTGCACGAGGAGCCGCCATATGT
>probe:Drosophila_2:1635998_at:263:13; Interrogation_Position=751; Antisense; ATATGTGCCCGGACCCGAGGAGACC
>probe:Drosophila_2:1635998_at:452:645; Interrogation_Position=792; Antisense; TCTTCTACGCCTTCGACTACAATGT
>probe:Drosophila_2:1635998_at:274:589; Interrogation_Position=925; Antisense; TGGATCCATCGCATCGCCTTGTATA
>probe:Drosophila_2:1635998_at:563:315; Interrogation_Position=940; Antisense; GCCTTGTATAGGTCGTTCTGTAGAA

Paste this into a BLAST search page for me
GATCGTACAAGTATGTCCAACCACAAACCACATGGCCGTGACTTTGTGGCTTTGTGGCCAACTATTATGCTGATAGATAAGACCGGTTTCCATGTGGAGGTGTGGAGGACAATCGTCCGGCACACTAAACTGCCGGCCACTAAGACTCCGTTATGCCGCCGAGTACCAGCAGGAGGTACCAGCAGGAGGGTCGCTACCAGGAGTACCAGCCCTACGTGCACGAGGACGTGCACGAGGAGCCGCCATATGTATATGTGCCCGGACCCGAGGAGACCTCTTCTACGCCTTCGACTACAATGTTGGATCCATCGCATCGCCTTGTATAGCCTTGTATAGGTCGTTCTGTAGAA

Full Affymetrix probeset data:

Annotations for 1635998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720