FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635999_at:

>probe:Drosophila_2:1635999_at:268:357; Interrogation_Position=105; Antisense; GCAAATTCAACAGGCCTGCATCAAG
>probe:Drosophila_2:1635999_at:262:7; Interrogation_Position=139; Antisense; ATTGCTGCCAGTGATGCTAATTTGC
>probe:Drosophila_2:1635999_at:3:339; Interrogation_Position=154; Antisense; GCTAATTTGCTGACCACCGACAAGG
>probe:Drosophila_2:1635999_at:178:235; Interrogation_Position=187; Antisense; AATCCCTCTGAGTCGGTGAAGTGCT
>probe:Drosophila_2:1635999_at:137:615; Interrogation_Position=203; Antisense; TGAAGTGCTATCACAGCTGCGTCTA
>probe:Drosophila_2:1635999_at:696:37; Interrogation_Position=22; Antisense; ATCTACTTGTTGGTTGTATTCCTAA
>probe:Drosophila_2:1635999_at:148:107; Interrogation_Position=230; Antisense; AGAAACTGGGTCTCCTGGGTGACGA
>probe:Drosophila_2:1635999_at:522:709; Interrogation_Position=281; Antisense; TTAAGTTGGCCCAGATCCGTTTCAG
>probe:Drosophila_2:1635999_at:367:349; Interrogation_Position=305; Antisense; GCAGTCTGCCGGTGGATAAGCTAAA
>probe:Drosophila_2:1635999_at:4:215; Interrogation_Position=328; Antisense; AAGAGTTTGCTTACCAGCTGCGGAA
>probe:Drosophila_2:1635999_at:413:313; Interrogation_Position=367; Antisense; GCCACCTGTGACTTTGTCTACAACT
>probe:Drosophila_2:1635999_at:360:481; Interrogation_Position=37; Antisense; GTATTCCTAATTTTCGCTCTAAGCG
>probe:Drosophila_2:1635999_at:565:205; Interrogation_Position=57; Antisense; AAGCGAACTAGTAGCGGGCCAGTCA
>probe:Drosophila_2:1635999_at:181:565; Interrogation_Position=87; Antisense; GGAATTGGCAGCCTACAAGCAAATT

Paste this into a BLAST search page for me
GCAAATTCAACAGGCCTGCATCAAGATTGCTGCCAGTGATGCTAATTTGCGCTAATTTGCTGACCACCGACAAGGAATCCCTCTGAGTCGGTGAAGTGCTTGAAGTGCTATCACAGCTGCGTCTAATCTACTTGTTGGTTGTATTCCTAAAGAAACTGGGTCTCCTGGGTGACGATTAAGTTGGCCCAGATCCGTTTCAGGCAGTCTGCCGGTGGATAAGCTAAAAAGAGTTTGCTTACCAGCTGCGGAAGCCACCTGTGACTTTGTCTACAACTGTATTCCTAATTTTCGCTCTAAGCGAAGCGAACTAGTAGCGGGCCAGTCAGGAATTGGCAGCCTACAAGCAAATT

Full Affymetrix probeset data:

Annotations for 1635999_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720