Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636000_at:

>probe:Drosophila_2:1636000_at:725:9; Interrogation_Position=102; Antisense; ATTCGAGTGGCGCTCTGTTCTTCAA
>probe:Drosophila_2:1636000_at:604:335; Interrogation_Position=183; Antisense; GCTACGGTCAGGGAAACTACGGCTA
>probe:Drosophila_2:1636000_at:634:457; Interrogation_Position=225; Antisense; GATATGGTTACAACTATCCCGCATA
>probe:Drosophila_2:1636000_at:704:45; Interrogation_Position=240; Antisense; ATCCCGCATATAATTCCTACTCTTA
>probe:Drosophila_2:1636000_at:485:63; Interrogation_Position=304; Antisense; AGGAGGACGCAAGCCTTCTGGAAAC
>probe:Drosophila_2:1636000_at:62:639; Interrogation_Position=320; Antisense; TCTGGAAACCGCAAAGGACGCACTT
>probe:Drosophila_2:1636000_at:396:555; Interrogation_Position=335; Antisense; GGACGCACTTACTCGGACATTCGAA
>probe:Drosophila_2:1636000_at:197:295; Interrogation_Position=356; Antisense; CGAAGAGTTATAAATCCCGATCCAT
>probe:Drosophila_2:1636000_at:102:211; Interrogation_Position=37; Antisense; AAGCAAGATGAGATCCCGCGATTCC
>probe:Drosophila_2:1636000_at:253:29; Interrogation_Position=379; Antisense; ATACATCGGTCCTGGAGGCAGTCGC
>probe:Drosophila_2:1636000_at:305:541; Interrogation_Position=437; Antisense; GGTTAACGATTCGACCGTCTGAACT
>probe:Drosophila_2:1636000_at:275:383; Interrogation_Position=457; Antisense; GAACTCGCATTGTTGTCAGCAGTAT
>probe:Drosophila_2:1636000_at:616:463; Interrogation_Position=56; Antisense; GATTCCCGATTGACTATCCTAACAT
>probe:Drosophila_2:1636000_at:350:661; Interrogation_Position=75; Antisense; TAACATTGCTGATTGCGTGCTGCCT

Paste this into a BLAST search page for me
ATTCGAGTGGCGCTCTGTTCTTCAAGCTACGGTCAGGGAAACTACGGCTAGATATGGTTACAACTATCCCGCATAATCCCGCATATAATTCCTACTCTTAAGGAGGACGCAAGCCTTCTGGAAACTCTGGAAACCGCAAAGGACGCACTTGGACGCACTTACTCGGACATTCGAACGAAGAGTTATAAATCCCGATCCATAAGCAAGATGAGATCCCGCGATTCCATACATCGGTCCTGGAGGCAGTCGCGGTTAACGATTCGACCGTCTGAACTGAACTCGCATTGTTGTCAGCAGTATGATTCCCGATTGACTATCCTAACATTAACATTGCTGATTGCGTGCTGCCT

Full Affymetrix probeset data:

Annotations for 1636000_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime