Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636001_at:

>probe:Drosophila_2:1636001_at:88:521; Interrogation_Position=113; Antisense; GTGGACGCCCTCAGTATCTGACCAA
>probe:Drosophila_2:1636001_at:220:39; Interrogation_Position=128; Antisense; ATCTGACCAAGTGGGAGGGCTATCC
>probe:Drosophila_2:1636001_at:185:435; Interrogation_Position=142; Antisense; GAGGGCTATCCCATAGAGCAGTGCA
>probe:Drosophila_2:1636001_at:157:27; Interrogation_Position=154; Antisense; ATAGAGCAGTGCACTTGGGAGCCCC
>probe:Drosophila_2:1636001_at:717:83; Interrogation_Position=161; Antisense; AGTGCACTTGGGAGCCCCTGGAGAA
>probe:Drosophila_2:1636001_at:636:107; Interrogation_Position=182; Antisense; AGAACTTGGGCAAGTGCATGACGCT
>probe:Drosophila_2:1636001_at:709:347; Interrogation_Position=197; Antisense; GCATGACGCTGATTGCGGATTACGA
>probe:Drosophila_2:1636001_at:567:453; Interrogation_Position=214; Antisense; GATTACGAGGCCGAACTATTCCAGC
>probe:Drosophila_2:1636001_at:292:165; Interrogation_Position=22; Antisense; AAATCCATCGATTTGGGCTTGGGTG
>probe:Drosophila_2:1636001_at:192:385; Interrogation_Position=226; Antisense; GAACTATTCCAGCAGAGCCGGGAGA
>probe:Drosophila_2:1636001_at:493:589; Interrogation_Position=35; Antisense; TGGGCTTGGGTGTCCGAAACGTCAA
>probe:Drosophila_2:1636001_at:661:197; Interrogation_Position=52; Antisense; AACGTCAAGGAGAAATCTTCGGAAT
>probe:Drosophila_2:1636001_at:62:479; Interrogation_Position=90; Antisense; GTTTCTAGGAAAGCGCTATCTGCGT
>probe:Drosophila_2:1636001_at:261:393; Interrogation_Position=98; Antisense; GAAAGCGCTATCTGCGTGGACGCCC

Paste this into a BLAST search page for me
GTGGACGCCCTCAGTATCTGACCAAATCTGACCAAGTGGGAGGGCTATCCGAGGGCTATCCCATAGAGCAGTGCAATAGAGCAGTGCACTTGGGAGCCCCAGTGCACTTGGGAGCCCCTGGAGAAAGAACTTGGGCAAGTGCATGACGCTGCATGACGCTGATTGCGGATTACGAGATTACGAGGCCGAACTATTCCAGCAAATCCATCGATTTGGGCTTGGGTGGAACTATTCCAGCAGAGCCGGGAGATGGGCTTGGGTGTCCGAAACGTCAAAACGTCAAGGAGAAATCTTCGGAATGTTTCTAGGAAAGCGCTATCTGCGTGAAAGCGCTATCTGCGTGGACGCCC

Full Affymetrix probeset data:

Annotations for 1636001_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime