Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636002_at:

>probe:Drosophila_2:1636002_at:145:597; Interrogation_Position=2069; Antisense; TGTACAGTGCTCACCAAAACCGGGA
>probe:Drosophila_2:1636002_at:29:409; Interrogation_Position=2104; Antisense; GACGGTGAGCATGGATCATCTTCAA
>probe:Drosophila_2:1636002_at:480:647; Interrogation_Position=2119; Antisense; TCATCTTCAACAAGGTCTGCAGCCG
>probe:Drosophila_2:1636002_at:240:291; Interrogation_Position=2144; Antisense; CGTGCAGATCTCTTTGGCGATTTTA
>probe:Drosophila_2:1636002_at:151:343; Interrogation_Position=2221; Antisense; GCTTCAGCAAGATCCCGGCCAGATT
>probe:Drosophila_2:1636002_at:413:93; Interrogation_Position=2241; Antisense; AGATTTAGCCCCAGAAAGCAACACT
>probe:Drosophila_2:1636002_at:290:489; Interrogation_Position=2303; Antisense; GTACAGCCATCAGCACTCGAGGTGA
>probe:Drosophila_2:1636002_at:562:433; Interrogation_Position=2321; Antisense; GAGGTGAAACTCTTGGCATACGCTT
>probe:Drosophila_2:1636002_at:320:343; Interrogation_Position=2336; Antisense; GCATACGCTTGCATTTCTAGGGTGG
>probe:Drosophila_2:1636002_at:529:151; Interrogation_Position=2418; Antisense; ACATAAGTTGCATCGGTCCGTGTAT
>probe:Drosophila_2:1636002_at:486:149; Interrogation_Position=2453; Antisense; ACTTCGTTAGGGAATGGCGCCAGCA
>probe:Drosophila_2:1636002_at:115:577; Interrogation_Position=2468; Antisense; GGCGCCAGCAAGACGGATACCGGAT
>probe:Drosophila_2:1636002_at:413:205; Interrogation_Position=2525; Antisense; AAGCGAGCGAGATGACACGTTTCAG
>probe:Drosophila_2:1636002_at:62:567; Interrogation_Position=2582; Antisense; GGCAGCCGTTCCACTGTACAAAATA

Paste this into a BLAST search page for me
TGTACAGTGCTCACCAAAACCGGGAGACGGTGAGCATGGATCATCTTCAATCATCTTCAACAAGGTCTGCAGCCGCGTGCAGATCTCTTTGGCGATTTTAGCTTCAGCAAGATCCCGGCCAGATTAGATTTAGCCCCAGAAAGCAACACTGTACAGCCATCAGCACTCGAGGTGAGAGGTGAAACTCTTGGCATACGCTTGCATACGCTTGCATTTCTAGGGTGGACATAAGTTGCATCGGTCCGTGTATACTTCGTTAGGGAATGGCGCCAGCAGGCGCCAGCAAGACGGATACCGGATAAGCGAGCGAGATGACACGTTTCAGGGCAGCCGTTCCACTGTACAAAATA

Full Affymetrix probeset data:

Annotations for 1636002_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime