Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636003_at:

>probe:Drosophila_2:1636003_at:163:159; Interrogation_Position=1266; Antisense; AAATCGTGCCCATGCTAAAGTTCCG
>probe:Drosophila_2:1636003_at:470:653; Interrogation_Position=1281; Antisense; TAAAGTTCCGGTCTGCTATTCTCCA
>probe:Drosophila_2:1636003_at:317:669; Interrogation_Position=1325; Antisense; TACTCGCATGCCTCGAAGAATTCGT
>probe:Drosophila_2:1636003_at:471:467; Interrogation_Position=1348; Antisense; GTTGAAAACCAATGCTCCACCAGCG
>probe:Drosophila_2:1636003_at:241:65; Interrogation_Position=1378; Antisense; ATGGGACATTCTGCGCAGCTGGAGC
>probe:Drosophila_2:1636003_at:392:111; Interrogation_Position=1400; Antisense; AGCAAGCGACATCCGGTAAATCCCG
>probe:Drosophila_2:1636003_at:200:225; Interrogation_Position=1426; Antisense; AAGGATGATTCCTGGATCTCCACTG
>probe:Drosophila_2:1636003_at:244:143; Interrogation_Position=1447; Antisense; ACTGGCGGCCATACTTTCGAAAGAA
>probe:Drosophila_2:1636003_at:253:233; Interrogation_Position=1470; Antisense; AATGCACTGCTGTCTACGAGTTCGA
>probe:Drosophila_2:1636003_at:136:571; Interrogation_Position=1534; Antisense; GGCATTATCGCGCTTCCAAGAGAAT
>probe:Drosophila_2:1636003_at:664:251; Interrogation_Position=1550; Antisense; CAAGAGAATCCGACTCCACATTGGG
>probe:Drosophila_2:1636003_at:305:563; Interrogation_Position=1580; Antisense; GGAACCAGAGCCACTATTATGATTG
>probe:Drosophila_2:1636003_at:174:189; Interrogation_Position=1647; Antisense; AACAGCGTCACAAAGCGTCGGAGCA
>probe:Drosophila_2:1636003_at:422:405; Interrogation_Position=1776; Antisense; GACTGCTTCTGTGTCCCAAATTTAT

Paste this into a BLAST search page for me
AAATCGTGCCCATGCTAAAGTTCCGTAAAGTTCCGGTCTGCTATTCTCCATACTCGCATGCCTCGAAGAATTCGTGTTGAAAACCAATGCTCCACCAGCGATGGGACATTCTGCGCAGCTGGAGCAGCAAGCGACATCCGGTAAATCCCGAAGGATGATTCCTGGATCTCCACTGACTGGCGGCCATACTTTCGAAAGAAAATGCACTGCTGTCTACGAGTTCGAGGCATTATCGCGCTTCCAAGAGAATCAAGAGAATCCGACTCCACATTGGGGGAACCAGAGCCACTATTATGATTGAACAGCGTCACAAAGCGTCGGAGCAGACTGCTTCTGTGTCCCAAATTTAT

Full Affymetrix probeset data:

Annotations for 1636003_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime