Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636006_at:

>probe:Drosophila_2:1636006_at:114:87; Interrogation_Position=5433; Antisense; AGTGCGGTAATGTATGGCGTTTCGT
>probe:Drosophila_2:1636006_at:272:327; Interrogation_Position=5449; Antisense; GCGTTTCGTGAGTAGTTAAGGTAAT
>probe:Drosophila_2:1636006_at:304:171; Interrogation_Position=5518; Antisense; AAAGCATAGCTAGGGCAAACGGGAA
>probe:Drosophila_2:1636006_at:29:475; Interrogation_Position=5557; Antisense; GTTCAAGCGAAAATTCACAACACAT
>probe:Drosophila_2:1636006_at:157:687; Interrogation_Position=5597; Antisense; TATACTTACCCTATATATCTGTATC
>probe:Drosophila_2:1636006_at:352:483; Interrogation_Position=5629; Antisense; GTATCTAATCCGTATCTGTATGTAT
>probe:Drosophila_2:1636006_at:673:697; Interrogation_Position=5672; Antisense; TTTAATATGTCTCTTATTCGCCCCT
>probe:Drosophila_2:1636006_at:66:635; Interrogation_Position=5689; Antisense; TCGCCCCTCTGCGTTCTTTTTAATT
>probe:Drosophila_2:1636006_at:355:679; Interrogation_Position=5716; Antisense; TAGTGCCTAACTTTTACCCATACTC
>probe:Drosophila_2:1636006_at:509:683; Interrogation_Position=5727; Antisense; TTTTACCCATACTCTTAGAACACGT
>probe:Drosophila_2:1636006_at:390:279; Interrogation_Position=5738; Antisense; CTCTTAGAACACGTATTTCTGTTTC
>probe:Drosophila_2:1636006_at:489:687; Interrogation_Position=5765; Antisense; TTTCTGTTTCTGTTTGTCGTTAATT
>probe:Drosophila_2:1636006_at:647:725; Interrogation_Position=5778; Antisense; TTGTCGTTAATTTCCAATGCGGAAA
>probe:Drosophila_2:1636006_at:633:615; Interrogation_Position=5861; Antisense; TGCAAGCAAACACAACTACACGAGA

Paste this into a BLAST search page for me
AGTGCGGTAATGTATGGCGTTTCGTGCGTTTCGTGAGTAGTTAAGGTAATAAAGCATAGCTAGGGCAAACGGGAAGTTCAAGCGAAAATTCACAACACATTATACTTACCCTATATATCTGTATCGTATCTAATCCGTATCTGTATGTATTTTAATATGTCTCTTATTCGCCCCTTCGCCCCTCTGCGTTCTTTTTAATTTAGTGCCTAACTTTTACCCATACTCTTTTACCCATACTCTTAGAACACGTCTCTTAGAACACGTATTTCTGTTTCTTTCTGTTTCTGTTTGTCGTTAATTTTGTCGTTAATTTCCAATGCGGAAATGCAAGCAAACACAACTACACGAGA

Full Affymetrix probeset data:

Annotations for 1636006_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime