Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636007_at:

>probe:Drosophila_2:1636007_at:266:627; Interrogation_Position=1298; Antisense; TGCCTGCACGTTTGAATCGCTTGTA
>probe:Drosophila_2:1636007_at:694:617; Interrogation_Position=1349; Antisense; TGCTACCCGTCTTCTATGTACTAGA
>probe:Drosophila_2:1636007_at:274:179; Interrogation_Position=1440; Antisense; AACAGAACTTTATACCGGAGCGGCT
>probe:Drosophila_2:1636007_at:324:55; Interrogation_Position=1484; Antisense; ATGAACAGTTCGATGTGCCGGCTAA
>probe:Drosophila_2:1636007_at:387:317; Interrogation_Position=1500; Antisense; GCCGGCTAAGCTTCTCATGGAGGTA
>probe:Drosophila_2:1636007_at:627:485; Interrogation_Position=1522; Antisense; GTAGATGACCAGTATGCCAGCAACT
>probe:Drosophila_2:1636007_at:401:285; Interrogation_Position=1549; Antisense; CTGAGCATTGTTCTGCAGTTCCAAT
>probe:Drosophila_2:1636007_at:225:389; Interrogation_Position=1578; Antisense; GAAACACTTTTGCACCATAACTGGT
>probe:Drosophila_2:1636007_at:499:593; Interrogation_Position=1613; Antisense; TGGGCAATCCCAGGAAACCCTTGGA
>probe:Drosophila_2:1636007_at:273:461; Interrogation_Position=1645; Antisense; GATTTATCCGATCAGCGAGGCATTG
>probe:Drosophila_2:1636007_at:289:101; Interrogation_Position=1671; Antisense; AGAGATTCTGAAACGCGCCATGTCC
>probe:Drosophila_2:1636007_at:312:285; Interrogation_Position=1696; Antisense; CTGGGATCTTCGGTTCACTATAGGG
>probe:Drosophila_2:1636007_at:713:169; Interrogation_Position=1728; Antisense; AAAGGTTCTTCTTGGTGAGCCGGAG
>probe:Drosophila_2:1636007_at:429:25; Interrogation_Position=1759; Antisense; ATAGATGGACTGCTCACCTACTTTC

Paste this into a BLAST search page for me
TGCCTGCACGTTTGAATCGCTTGTATGCTACCCGTCTTCTATGTACTAGAAACAGAACTTTATACCGGAGCGGCTATGAACAGTTCGATGTGCCGGCTAAGCCGGCTAAGCTTCTCATGGAGGTAGTAGATGACCAGTATGCCAGCAACTCTGAGCATTGTTCTGCAGTTCCAATGAAACACTTTTGCACCATAACTGGTTGGGCAATCCCAGGAAACCCTTGGAGATTTATCCGATCAGCGAGGCATTGAGAGATTCTGAAACGCGCCATGTCCCTGGGATCTTCGGTTCACTATAGGGAAAGGTTCTTCTTGGTGAGCCGGAGATAGATGGACTGCTCACCTACTTTC

Full Affymetrix probeset data:

Annotations for 1636007_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime