FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636008_at:

>probe:Drosophila_2:1636008_at:217:573; Interrogation_Position=1118; Antisense; GGCTCTTTATTTGACCTTCTGTACA
>probe:Drosophila_2:1636008_at:383:275; Interrogation_Position=1133; Antisense; CTTCTGTACAGTGCGTTTCGTGACA
>probe:Drosophila_2:1636008_at:566:619; Interrogation_Position=1175; Antisense; TGCATTGCCGGGTCATCACAAATGA
>probe:Drosophila_2:1636008_at:670:607; Interrogation_Position=1197; Antisense; TGAGCTCGAAAGGATGCGGCTTTGT
>probe:Drosophila_2:1636008_at:601:173; Interrogation_Position=1288; Antisense; AAAGCGGCGCACATTTTGTAGCAAA
>probe:Drosophila_2:1636008_at:17:387; Interrogation_Position=1327; Antisense; GAAAATCCCCAAGAAGGCGGTCGAG
>probe:Drosophila_2:1636008_at:485:109; Interrogation_Position=1350; Antisense; AGAAGTTTTGTAGCGAGGCCTTGTT
>probe:Drosophila_2:1636008_at:377:181; Interrogation_Position=1383; Antisense; AAAAATAAGAATCAGCCGCGCGCGC
>probe:Drosophila_2:1636008_at:361:721; Interrogation_Position=1408; Antisense; TTGCGCATAAATTTCCAAGCCCCAA
>probe:Drosophila_2:1636008_at:197:205; Interrogation_Position=1424; Antisense; AAGCCCCAATCGGAGCAGAGTACCA
>probe:Drosophila_2:1636008_at:93:115; Interrogation_Position=1494; Antisense; AGCAGCAAGAGCATGCCCCAATCTG
>probe:Drosophila_2:1636008_at:144:303; Interrogation_Position=1509; Antisense; CCCCAATCTGCATATACAAGCCATA
>probe:Drosophila_2:1636008_at:416:271; Interrogation_Position=947; Antisense; CATAGCAGCCGGGTATGGCAACGTG
>probe:Drosophila_2:1636008_at:439:563; Interrogation_Position=963; Antisense; GGCAACGTGAGTATCCTTAAACTGG

Paste this into a BLAST search page for me
GGCTCTTTATTTGACCTTCTGTACACTTCTGTACAGTGCGTTTCGTGACATGCATTGCCGGGTCATCACAAATGATGAGCTCGAAAGGATGCGGCTTTGTAAAGCGGCGCACATTTTGTAGCAAAGAAAATCCCCAAGAAGGCGGTCGAGAGAAGTTTTGTAGCGAGGCCTTGTTAAAAATAAGAATCAGCCGCGCGCGCTTGCGCATAAATTTCCAAGCCCCAAAAGCCCCAATCGGAGCAGAGTACCAAGCAGCAAGAGCATGCCCCAATCTGCCCCAATCTGCATATACAAGCCATACATAGCAGCCGGGTATGGCAACGTGGGCAACGTGAGTATCCTTAAACTGG

Full Affymetrix probeset data:

Annotations for 1636008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720