Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636009_at:

>probe:Drosophila_2:1636009_at:340:623; Interrogation_Position=1190; Antisense; TGCCCGCCTACATACGAAGCAAGGT
>probe:Drosophila_2:1636009_at:135:65; Interrogation_Position=1243; Antisense; ATGGGCAACCATCAGGTGTACCGCG
>probe:Drosophila_2:1636009_at:538:541; Interrogation_Position=1276; Antisense; GGATACGCCGATCATGTGGTACATC
>probe:Drosophila_2:1636009_at:426:407; Interrogation_Position=1359; Antisense; GATCGTTGACTATACGGCCCGGAGA
>probe:Drosophila_2:1636009_at:658:549; Interrogation_Position=1379; Antisense; GGAGATTTGGCTCACTGCTCTTCGA
>probe:Drosophila_2:1636009_at:427:143; Interrogation_Position=1392; Antisense; ACTGCTCTTCGATCGAGTGGACAAC
>probe:Drosophila_2:1636009_at:235:585; Interrogation_Position=1409; Antisense; TGGACAACACGTGCCTGGAGGTTTT
>probe:Drosophila_2:1636009_at:709:539; Interrogation_Position=1428; Antisense; GGTTTTTCTAAATCGCGGCATCTGC
>probe:Drosophila_2:1636009_at:20:347; Interrogation_Position=1445; Antisense; GCATCTGCGATCTGGTGTAGCCCGA
>probe:Drosophila_2:1636009_at:376:515; Interrogation_Position=1459; Antisense; GTGTAGCCCGATCTTCGAGAGACGC
>probe:Drosophila_2:1636009_at:725:241; Interrogation_Position=1493; Antisense; AATACCACAGATCTCTCGGGTCAGT
>probe:Drosophila_2:1636009_at:130:283; Interrogation_Position=1509; Antisense; CGGGTCAGTTGTGTTCGTGGCCTCA
>probe:Drosophila_2:1636009_at:13:675; Interrogation_Position=1624; Antisense; TAGAATAAGTCCTAGCCGTTCCCAT
>probe:Drosophila_2:1636009_at:151:277; Interrogation_Position=1635; Antisense; CTAGCCGTTCCCATATAAGTGTTAT

Paste this into a BLAST search page for me
TGCCCGCCTACATACGAAGCAAGGTATGGGCAACCATCAGGTGTACCGCGGGATACGCCGATCATGTGGTACATCGATCGTTGACTATACGGCCCGGAGAGGAGATTTGGCTCACTGCTCTTCGAACTGCTCTTCGATCGAGTGGACAACTGGACAACACGTGCCTGGAGGTTTTGGTTTTTCTAAATCGCGGCATCTGCGCATCTGCGATCTGGTGTAGCCCGAGTGTAGCCCGATCTTCGAGAGACGCAATACCACAGATCTCTCGGGTCAGTCGGGTCAGTTGTGTTCGTGGCCTCATAGAATAAGTCCTAGCCGTTCCCATCTAGCCGTTCCCATATAAGTGTTAT

Full Affymetrix probeset data:

Annotations for 1636009_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime