FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636012_at:

>probe:Drosophila_2:1636012_at:310:319; Interrogation_Position=100; Antisense; GCTCCGTTTCGGTTTGGCGAGAACT
>probe:Drosophila_2:1636012_at:363:41; Interrogation_Position=159; Antisense; ATCGGTTCACGTTATCCAGTTGCAG
>probe:Drosophila_2:1636012_at:497:587; Interrogation_Position=194; Antisense; TGGAGCGCGAGGATCACTATATGAA
>probe:Drosophila_2:1636012_at:541:377; Interrogation_Position=216; Antisense; GAACCACTTTCACCAAAACACGGAG
>probe:Drosophila_2:1636012_at:376:179; Interrogation_Position=231; Antisense; AAACACGGAGAATCTGCAGCGCTAC
>probe:Drosophila_2:1636012_at:195:19; Interrogation_Position=27; Antisense; ATTTGTTTACCTGGTTCTCATCCTG
>probe:Drosophila_2:1636012_at:416:451; Interrogation_Position=294; Antisense; GATCGAGCGGACATATCCCACGGAT
>probe:Drosophila_2:1636012_at:486:447; Interrogation_Position=316; Antisense; GATGCGGTGATAAATCCTGCCTATA
>probe:Drosophila_2:1636012_at:443:235; Interrogation_Position=328; Antisense; AATCCTGCCTATATGCACGACGAGG
>probe:Drosophila_2:1636012_at:487:557; Interrogation_Position=351; Antisense; GGACTACGTGATCAATGCACCTCCT
>probe:Drosophila_2:1636012_at:391:81; Interrogation_Position=407; Antisense; AGGTGTATCCACAGGTGCGCCACAA
>probe:Drosophila_2:1636012_at:471:631; Interrogation_Position=47; Antisense; TCCTGGGCTGGATACTGATCGTTCT
>probe:Drosophila_2:1636012_at:97:451; Interrogation_Position=63; Antisense; GATCGTTCTGTTCCTGAAGTGCAAA
>probe:Drosophila_2:1636012_at:555:217; Interrogation_Position=79; Antisense; AAGTGCAAAAAGTCCTTGGCCGCTC

Paste this into a BLAST search page for me
GCTCCGTTTCGGTTTGGCGAGAACTATCGGTTCACGTTATCCAGTTGCAGTGGAGCGCGAGGATCACTATATGAAGAACCACTTTCACCAAAACACGGAGAAACACGGAGAATCTGCAGCGCTACATTTGTTTACCTGGTTCTCATCCTGGATCGAGCGGACATATCCCACGGATGATGCGGTGATAAATCCTGCCTATAAATCCTGCCTATATGCACGACGAGGGGACTACGTGATCAATGCACCTCCTAGGTGTATCCACAGGTGCGCCACAATCCTGGGCTGGATACTGATCGTTCTGATCGTTCTGTTCCTGAAGTGCAAAAAGTGCAAAAAGTCCTTGGCCGCTC

Full Affymetrix probeset data:

Annotations for 1636012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720