Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636013_at:

>probe:Drosophila_2:1636013_at:476:89; Interrogation_Position=1134; Antisense; AGTAATACTCCCTCATTACCAGAGC
>probe:Drosophila_2:1636013_at:166:711; Interrogation_Position=1176; Antisense; TTCTCAACCGACCTATTTTGGGACA
>probe:Drosophila_2:1636013_at:259:285; Interrogation_Position=1214; Antisense; CTGCACCCAATCAAATCCTGTTATG
>probe:Drosophila_2:1636013_at:113:165; Interrogation_Position=1226; Antisense; AAATCCTGTTATGCCCAATACGAGT
>probe:Drosophila_2:1636013_at:454:241; Interrogation_Position=1242; Antisense; AATACGAGTTTGATCCCGGTTCTGC
>probe:Drosophila_2:1636013_at:705:201; Interrogation_Position=1295; Antisense; AACCTGTGAGCCTTCAGTTCAATAC
>probe:Drosophila_2:1636013_at:471:469; Interrogation_Position=1311; Antisense; GTTCAATACAAAGTGGCGTCCCGCT
>probe:Drosophila_2:1636013_at:185:343; Interrogation_Position=1347; Antisense; GCACCGGTGCCGAAGTACCTGGGAA
>probe:Drosophila_2:1636013_at:693:425; Interrogation_Position=1381; Antisense; GAGATCGACGTTTAAGCCTGCTCCG
>probe:Drosophila_2:1636013_at:465:487; Interrogation_Position=1445; Antisense; GTACGAGTTTAGTGCCTCATGGATT
>probe:Drosophila_2:1636013_at:671:13; Interrogation_Position=1467; Antisense; ATTAGTGGGCGTGCTTTGTGCGCCA
>probe:Drosophila_2:1636013_at:666:685; Interrogation_Position=1503; Antisense; TATCTTCCCGACCTCATTGACAAAA
>probe:Drosophila_2:1636013_at:724:247; Interrogation_Position=1589; Antisense; AATTGGTGTTTCTGATTCCGTCGAT
>probe:Drosophila_2:1636013_at:69:523; Interrogation_Position=1635; Antisense; GGGCGTCCCAACCTAGAGAAGATCG

Paste this into a BLAST search page for me
AGTAATACTCCCTCATTACCAGAGCTTCTCAACCGACCTATTTTGGGACACTGCACCCAATCAAATCCTGTTATGAAATCCTGTTATGCCCAATACGAGTAATACGAGTTTGATCCCGGTTCTGCAACCTGTGAGCCTTCAGTTCAATACGTTCAATACAAAGTGGCGTCCCGCTGCACCGGTGCCGAAGTACCTGGGAAGAGATCGACGTTTAAGCCTGCTCCGGTACGAGTTTAGTGCCTCATGGATTATTAGTGGGCGTGCTTTGTGCGCCATATCTTCCCGACCTCATTGACAAAAAATTGGTGTTTCTGATTCCGTCGATGGGCGTCCCAACCTAGAGAAGATCG

Full Affymetrix probeset data:

Annotations for 1636013_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime