FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636014_at:

>probe:Drosophila_2:1636014_at:514:487; Interrogation_Position=132; Antisense; GTACCCACCGCACAGAGAATCAGAT
>probe:Drosophila_2:1636014_at:82:111; Interrogation_Position=147; Antisense; AGAATCAGATCGAGTCCCAGTGCAC
>probe:Drosophila_2:1636014_at:684:155; Interrogation_Position=173; Antisense; ACAGCAGCTTGTACCGCGAGCAGGT
>probe:Drosophila_2:1636014_at:63:97; Interrogation_Position=19; Antisense; AGATCCTGGCAGGACGAAGGCTTCG
>probe:Drosophila_2:1636014_at:585:533; Interrogation_Position=195; Antisense; GGTGGTGCACTCCAATTACGGATCG
>probe:Drosophila_2:1636014_at:683:451; Interrogation_Position=215; Antisense; GATCGGCACGTAGCGTCCATCAAGA
>probe:Drosophila_2:1636014_at:537:295; Interrogation_Position=310; Antisense; CGAAAGAATTACATCCTGCCGGGCA
>probe:Drosophila_2:1636014_at:303:63; Interrogation_Position=334; Antisense; AGGCTGCTCCGAAGCGACCGTCAGT
>probe:Drosophila_2:1636014_at:268:369; Interrogation_Position=34; Antisense; GAAGGCTTCGGCAAGGCAAAGGCAA
>probe:Drosophila_2:1636014_at:544:411; Interrogation_Position=349; Antisense; GACCGTCAGTGTCGCCCATATGAGA
>probe:Drosophila_2:1636014_at:266:709; Interrogation_Position=423; Antisense; TTACAAGCACACAAACCACGTCTAT
>probe:Drosophila_2:1636014_at:374:175; Interrogation_Position=435; Antisense; AAACCACGTCTATGGACTCCAATTG
>probe:Drosophila_2:1636014_at:211:281; Interrogation_Position=451; Antisense; CTCCAATTGAGGCATCGACACGAAG
>probe:Drosophila_2:1636014_at:456:607; Interrogation_Position=96; Antisense; TGAGGTGAGGACTCCATTTGGCTGC

Paste this into a BLAST search page for me
GTACCCACCGCACAGAGAATCAGATAGAATCAGATCGAGTCCCAGTGCACACAGCAGCTTGTACCGCGAGCAGGTAGATCCTGGCAGGACGAAGGCTTCGGGTGGTGCACTCCAATTACGGATCGGATCGGCACGTAGCGTCCATCAAGACGAAAGAATTACATCCTGCCGGGCAAGGCTGCTCCGAAGCGACCGTCAGTGAAGGCTTCGGCAAGGCAAAGGCAAGACCGTCAGTGTCGCCCATATGAGATTACAAGCACACAAACCACGTCTATAAACCACGTCTATGGACTCCAATTGCTCCAATTGAGGCATCGACACGAAGTGAGGTGAGGACTCCATTTGGCTGC

Full Affymetrix probeset data:

Annotations for 1636014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720