FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636021_at:

>probe:Drosophila_2:1636021_at:253:181; Interrogation_Position=110; Antisense; AAAACTCCAGTTTGACGACCGTGTG
>probe:Drosophila_2:1636021_at:537:411; Interrogation_Position=126; Antisense; GACCGTGTGCAGCACTTTTCCATTG
>probe:Drosophila_2:1636021_at:187:701; Interrogation_Position=141; Antisense; TTTTCCATTGTCCTCGAGGATCGAA
>probe:Drosophila_2:1636021_at:699:545; Interrogation_Position=158; Antisense; GGATCGAAAGCTACCATCACTGGCA
>probe:Drosophila_2:1636021_at:442:287; Interrogation_Position=177; Antisense; CTGGCAGCCGATAGACATCGACATT
>probe:Drosophila_2:1636021_at:727:635; Interrogation_Position=194; Antisense; TCGACATTGGGCGAGAGGACATCTT
>probe:Drosophila_2:1636021_at:229:557; Interrogation_Position=210; Antisense; GGACATCTTGGAACGTAAATTGGAA
>probe:Drosophila_2:1636021_at:19:101; Interrogation_Position=239; Antisense; AGAGTGAGCGAATGGTCCAGCCCGC
>probe:Drosophila_2:1636021_at:471:61; Interrogation_Position=265; Antisense; ATGTCCATTCCACTCGCCCTAAATG
>probe:Drosophila_2:1636021_at:25:301; Interrogation_Position=279; Antisense; CGCCCTAAATGCCATGCATCCTTAA
>probe:Drosophila_2:1636021_at:74:221; Interrogation_Position=52; Antisense; AAGGATCTCGACGAGGTAACCACGA
>probe:Drosophila_2:1636021_at:427:79; Interrogation_Position=65; Antisense; AGGTAACCACGAGCAGCGAGGAGCA
>probe:Drosophila_2:1636021_at:414:351; Interrogation_Position=77; Antisense; GCAGCGAGGAGCAGTACAACCATGA
>probe:Drosophila_2:1636021_at:678:159; Interrogation_Position=92; Antisense; ACAACCATGACCTGACCAAAAACTC

Paste this into a BLAST search page for me
AAAACTCCAGTTTGACGACCGTGTGGACCGTGTGCAGCACTTTTCCATTGTTTTCCATTGTCCTCGAGGATCGAAGGATCGAAAGCTACCATCACTGGCACTGGCAGCCGATAGACATCGACATTTCGACATTGGGCGAGAGGACATCTTGGACATCTTGGAACGTAAATTGGAAAGAGTGAGCGAATGGTCCAGCCCGCATGTCCATTCCACTCGCCCTAAATGCGCCCTAAATGCCATGCATCCTTAAAAGGATCTCGACGAGGTAACCACGAAGGTAACCACGAGCAGCGAGGAGCAGCAGCGAGGAGCAGTACAACCATGAACAACCATGACCTGACCAAAAACTC

Full Affymetrix probeset data:

Annotations for 1636021_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720