FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636022_at:

>probe:Drosophila_2:1636022_at:385:663; Interrogation_Position=149; Antisense; TAAACAAGTCAGCTGCCAGTTGGCT
>probe:Drosophila_2:1636022_at:434:101; Interrogation_Position=28; Antisense; AGAGCTTTGCTTGCTGACTTTGCCA
>probe:Drosophila_2:1636022_at:447:247; Interrogation_Position=298; Antisense; AATTGTGCTTTGTTTGCTACCCGCT
>probe:Drosophila_2:1636022_at:267:673; Interrogation_Position=315; Antisense; TACCCGCTGGCAGGAGCTGACCAAA
>probe:Drosophila_2:1636022_at:18:411; Interrogation_Position=347; Antisense; GACCCATTGTCGTCGTAGGTTGGAC
>probe:Drosophila_2:1636022_at:298:465; Interrogation_Position=365; Antisense; GTTGGACTCACCTTGAAACTCCTTG
>probe:Drosophila_2:1636022_at:357:617; Interrogation_Position=395; Antisense; TGCACTCACTGACGTCACAATGTTG
>probe:Drosophila_2:1636022_at:355:455; Interrogation_Position=473; Antisense; GATAACAAAGACGTACTCGCCCTTG
>probe:Drosophila_2:1636022_at:519:95; Interrogation_Position=513; Antisense; AGATCCCCGATGGTGGTCAGGGCCA
>probe:Drosophila_2:1636022_at:555:645; Interrogation_Position=529; Antisense; TCAGGGCCAGGGTGCACCAGTAGTA
>probe:Drosophila_2:1636022_at:197:355; Interrogation_Position=542; Antisense; GCACCAGTAGTAGCTCTGCAGATAC
>probe:Drosophila_2:1636022_at:23:617; Interrogation_Position=558; Antisense; TGCAGATACTGCTTGACCACGTCCG
>probe:Drosophila_2:1636022_at:163:397; Interrogation_Position=585; Antisense; GACTCCGAGTCGTGGTAGACCCAGT
>probe:Drosophila_2:1636022_at:531:537; Interrogation_Position=598; Antisense; GGTAGACCCAGTTGCGTGATCCGAA

Paste this into a BLAST search page for me
TAAACAAGTCAGCTGCCAGTTGGCTAGAGCTTTGCTTGCTGACTTTGCCAAATTGTGCTTTGTTTGCTACCCGCTTACCCGCTGGCAGGAGCTGACCAAAGACCCATTGTCGTCGTAGGTTGGACGTTGGACTCACCTTGAAACTCCTTGTGCACTCACTGACGTCACAATGTTGGATAACAAAGACGTACTCGCCCTTGAGATCCCCGATGGTGGTCAGGGCCATCAGGGCCAGGGTGCACCAGTAGTAGCACCAGTAGTAGCTCTGCAGATACTGCAGATACTGCTTGACCACGTCCGGACTCCGAGTCGTGGTAGACCCAGTGGTAGACCCAGTTGCGTGATCCGAA

Full Affymetrix probeset data:

Annotations for 1636022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720