FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636024_at:

>probe:Drosophila_2:1636024_at:44:181; Interrogation_Position=121; Antisense; AAACAGCAGCACATCATAAAGTTCG
>probe:Drosophila_2:1636024_at:409:355; Interrogation_Position=129; Antisense; GCACATCATAAAGTTCGTAAAGACC
>probe:Drosophila_2:1636024_at:569:717; Interrogation_Position=142; Antisense; TTCGTAAAGACCGAGAACGTGCAAC
>probe:Drosophila_2:1636024_at:294:491; Interrogation_Position=145; Antisense; GTAAAGACCGAGAACGTGCAACGTG
>probe:Drosophila_2:1636024_at:254:213; Interrogation_Position=148; Antisense; AAGACCGAGAACGTGCAACGTGCCT
>probe:Drosophila_2:1636024_at:682:411; Interrogation_Position=150; Antisense; GACCGAGAACGTGCAACGTGCCTTT
>probe:Drosophila_2:1636024_at:258:253; Interrogation_Position=163; Antisense; CAACGTGCCTTTAAGGATGGTTGCT
>probe:Drosophila_2:1636024_at:26:141; Interrogation_Position=165; Antisense; ACGTGCCTTTAAGGATGGTTGCTGA
>probe:Drosophila_2:1636024_at:685:595; Interrogation_Position=18; Antisense; TGTCCTTCAGCGTCAAATGGAGTCC
>probe:Drosophila_2:1636024_at:166:305; Interrogation_Position=21; Antisense; CCTTCAGCGTCAAATGGAGTCCCAG
>probe:Drosophila_2:1636024_at:439:649; Interrogation_Position=24; Antisense; TCAGCGTCAAATGGAGTCCCAGCAG
>probe:Drosophila_2:1636024_at:289:453; Interrogation_Position=73; Antisense; GATCTCAACAGTGTGCTGATATGGG
>probe:Drosophila_2:1636024_at:293:255; Interrogation_Position=78; Antisense; CAACAGTGTGCTGATATGGGACAAG
>probe:Drosophila_2:1636024_at:382:153; Interrogation_Position=80; Antisense; ACAGTGTGCTGATATGGGACAAGTT

Paste this into a BLAST search page for me
AAACAGCAGCACATCATAAAGTTCGGCACATCATAAAGTTCGTAAAGACCTTCGTAAAGACCGAGAACGTGCAACGTAAAGACCGAGAACGTGCAACGTGAAGACCGAGAACGTGCAACGTGCCTGACCGAGAACGTGCAACGTGCCTTTCAACGTGCCTTTAAGGATGGTTGCTACGTGCCTTTAAGGATGGTTGCTGATGTCCTTCAGCGTCAAATGGAGTCCCCTTCAGCGTCAAATGGAGTCCCAGTCAGCGTCAAATGGAGTCCCAGCAGGATCTCAACAGTGTGCTGATATGGGCAACAGTGTGCTGATATGGGACAAGACAGTGTGCTGATATGGGACAAGTT

Full Affymetrix probeset data:

Annotations for 1636024_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720