Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636025_at:

>probe:Drosophila_2:1636025_at:257:461; Interrogation_Position=1132; Antisense; GATTATTACCAATCGTGGCTCGCAG
>probe:Drosophila_2:1636025_at:725:337; Interrogation_Position=1149; Antisense; GCTCGCAGGCCATTTGTTTTTATAA
>probe:Drosophila_2:1636025_at:476:649; Interrogation_Position=1183; Antisense; TAAGCCCAGAACGTTTGTTTCGATT
>probe:Drosophila_2:1636025_at:442:185; Interrogation_Position=1307; Antisense; AACAAATTGAGTGCCTCGTTCTCGC
>probe:Drosophila_2:1636025_at:567:637; Interrogation_Position=1322; Antisense; TCGTTCTCGCGCGTAGAAATCTAAA
>probe:Drosophila_2:1636025_at:12:603; Interrogation_Position=1358; Antisense; TGTATTACACCCACGGCATTTTTGT
>probe:Drosophila_2:1636025_at:655:343; Interrogation_Position=1373; Antisense; GCATTTTTGTACTATACCCGCAGCT
>probe:Drosophila_2:1636025_at:645:323; Interrogation_Position=1405; Antisense; GCGCACAACTCACTTAACGATACTT
>probe:Drosophila_2:1636025_at:118:139; Interrogation_Position=1421; Antisense; ACGATACTTTTGTACATGTCCCCAG
>probe:Drosophila_2:1636025_at:472:667; Interrogation_Position=1433; Antisense; TACATGTCCCCAGTCGGATCCGGAT
>probe:Drosophila_2:1636025_at:289:449; Interrogation_Position=1455; Antisense; GATCCTATGGTTTATTGTTCGCCAA
>probe:Drosophila_2:1636025_at:291:471; Interrogation_Position=1471; Antisense; GTTCGCCAAATGTATTGCAACAGTT
>probe:Drosophila_2:1636025_at:445:617; Interrogation_Position=1495; Antisense; TGCTTTAGCCGCAATCTTGTTTTAA
>probe:Drosophila_2:1636025_at:445:601; Interrogation_Position=1512; Antisense; TGTTTTAACTCTTATACACTGCTTA

Paste this into a BLAST search page for me
GATTATTACCAATCGTGGCTCGCAGGCTCGCAGGCCATTTGTTTTTATAATAAGCCCAGAACGTTTGTTTCGATTAACAAATTGAGTGCCTCGTTCTCGCTCGTTCTCGCGCGTAGAAATCTAAATGTATTACACCCACGGCATTTTTGTGCATTTTTGTACTATACCCGCAGCTGCGCACAACTCACTTAACGATACTTACGATACTTTTGTACATGTCCCCAGTACATGTCCCCAGTCGGATCCGGATGATCCTATGGTTTATTGTTCGCCAAGTTCGCCAAATGTATTGCAACAGTTTGCTTTAGCCGCAATCTTGTTTTAATGTTTTAACTCTTATACACTGCTTA

Full Affymetrix probeset data:

Annotations for 1636025_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime