Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636026_at:

>probe:Drosophila_2:1636026_at:478:77; Interrogation_Position=6905; Antisense; AGAGTAATCCCGAATTGACCTTCCG
>probe:Drosophila_2:1636026_at:565:297; Interrogation_Position=6915; Antisense; CGAATTGACCTTCCGCGGTGAGCCC
>probe:Drosophila_2:1636026_at:129:535; Interrogation_Position=6931; Antisense; GGTGAGCCCAGCTACGATCTGCAAA
>probe:Drosophila_2:1636026_at:132:671; Interrogation_Position=6943; Antisense; TACGATCTGCAAAACGCTGCCATCG
>probe:Drosophila_2:1636026_at:358:335; Interrogation_Position=6958; Antisense; GCTGCCATCGAAATTGCCAGTGATT
>probe:Drosophila_2:1636026_at:132:377; Interrogation_Position=6993; Antisense; GAAGCACGTTCTGCGAGTCAAGCTC
>probe:Drosophila_2:1636026_at:455:89; Interrogation_Position=7008; Antisense; AGTCAAGCTCGCCAACGGTGCCTTG
>probe:Drosophila_2:1636026_at:539:197; Interrogation_Position=7021; Antisense; AACGGTGCCTTGTTCTTGCTGCAGG
>probe:Drosophila_2:1636026_at:232:619; Interrogation_Position=7040; Antisense; TGCAGGCCCATGACGACACCGAGAT
>probe:Drosophila_2:1636026_at:168:399; Interrogation_Position=7054; Antisense; GACACCGAGATGTCCCAGTGGGTGA
>probe:Drosophila_2:1636026_at:396:529; Interrogation_Position=7073; Antisense; GGGTGACCTCCCTGAAAGCCCAGAG
>probe:Drosophila_2:1636026_at:546:205; Interrogation_Position=7088; Antisense; AAGCCCAGAGCGATTCGACAGCGGT
>probe:Drosophila_2:1636026_at:641:377; Interrogation_Position=7159; Antisense; GAACCAAAGCGCAGATCGTTTTTTA
>probe:Drosophila_2:1636026_at:663:155; Interrogation_Position=7205; Antisense; ACAGCCGTAACGCAACCATAAGCAA

Paste this into a BLAST search page for me
AGAGTAATCCCGAATTGACCTTCCGCGAATTGACCTTCCGCGGTGAGCCCGGTGAGCCCAGCTACGATCTGCAAATACGATCTGCAAAACGCTGCCATCGGCTGCCATCGAAATTGCCAGTGATTGAAGCACGTTCTGCGAGTCAAGCTCAGTCAAGCTCGCCAACGGTGCCTTGAACGGTGCCTTGTTCTTGCTGCAGGTGCAGGCCCATGACGACACCGAGATGACACCGAGATGTCCCAGTGGGTGAGGGTGACCTCCCTGAAAGCCCAGAGAAGCCCAGAGCGATTCGACAGCGGTGAACCAAAGCGCAGATCGTTTTTTAACAGCCGTAACGCAACCATAAGCAA

Full Affymetrix probeset data:

Annotations for 1636026_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime