Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636028_at:

>probe:Drosophila_2:1636028_at:328:645; Interrogation_Position=1402; Antisense; TCTTTTCCTGCCTTGGATCAATGGA
>probe:Drosophila_2:1636028_at:319:653; Interrogation_Position=1458; Antisense; TAATAGCCATGTCCTGGGTGAGCCT
>probe:Drosophila_2:1636028_at:234:519; Interrogation_Position=1541; Antisense; GTGGAGCAGTGCGACTACAGCTTTA
>probe:Drosophila_2:1636028_at:397:99; Interrogation_Position=1612; Antisense; AGAGGACATTTTTCCGCTCTATCGG
>probe:Drosophila_2:1636028_at:646:337; Interrogation_Position=1627; Antisense; GCTCTATCGGATCTCGTACATGTGG
>probe:Drosophila_2:1636028_at:339:533; Interrogation_Position=1664; Antisense; GGTGCCTCCATTACGATTTTCGTGG
>probe:Drosophila_2:1636028_at:355:15; Interrogation_Position=1679; Antisense; ATTTTCGTGGCATTGCTAGGCACCT
>probe:Drosophila_2:1636028_at:320:277; Interrogation_Position=1694; Antisense; CTAGGCACCTTCGTGTTTGGCAAAA
>probe:Drosophila_2:1636028_at:565:133; Interrogation_Position=1751; Antisense; ACGCCCTGCATACGAAAGTTCTTTG
>probe:Drosophila_2:1636028_at:691:171; Interrogation_Position=1765; Antisense; AAAGTTCTTTGCCTTTGGCTCAGAG
>probe:Drosophila_2:1636028_at:261:207; Interrogation_Position=1832; Antisense; AAGCTCCGTAACGACGAGGTGGCCT
>probe:Drosophila_2:1636028_at:368:199; Interrogation_Position=1869; Antisense; AACCGAATCGTAACTGGCTACACCT
>probe:Drosophila_2:1636028_at:512:479; Interrogation_Position=1914; Antisense; GTTTCCATTTCAACCCAATCGATTT
>probe:Drosophila_2:1636028_at:265:233; Interrogation_Position=1930; Antisense; AATCGATTTTCATCCGTATTGCAAT

Paste this into a BLAST search page for me
TCTTTTCCTGCCTTGGATCAATGGATAATAGCCATGTCCTGGGTGAGCCTGTGGAGCAGTGCGACTACAGCTTTAAGAGGACATTTTTCCGCTCTATCGGGCTCTATCGGATCTCGTACATGTGGGGTGCCTCCATTACGATTTTCGTGGATTTTCGTGGCATTGCTAGGCACCTCTAGGCACCTTCGTGTTTGGCAAAAACGCCCTGCATACGAAAGTTCTTTGAAAGTTCTTTGCCTTTGGCTCAGAGAAGCTCCGTAACGACGAGGTGGCCTAACCGAATCGTAACTGGCTACACCTGTTTCCATTTCAACCCAATCGATTTAATCGATTTTCATCCGTATTGCAAT

Full Affymetrix probeset data:

Annotations for 1636028_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime