Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636029_s_at:

>probe:Drosophila_2:1636029_s_at:171:533; Interrogation_Position=287; Antisense; GGTCGCAAGGGCTCGATCTGGCCAC
>probe:Drosophila_2:1636029_s_at:385:41; Interrogation_Position=302; Antisense; ATCTGGCCACTGACTTTCGGTTTGG
>probe:Drosophila_2:1636029_s_at:3:539; Interrogation_Position=320; Antisense; GGTTTGGCCTGCTGTGCCGTCGAAA
>probe:Drosophila_2:1636029_s_at:10:395; Interrogation_Position=341; Antisense; GAAATGATGCACATCGCTGCTCCGC
>probe:Drosophila_2:1636029_s_at:515:619; Interrogation_Position=358; Antisense; TGCTCCGCGTTACGACATGGATCGA
>probe:Drosophila_2:1636029_s_at:398:457; Interrogation_Position=381; Antisense; GATATGGTGTTGTGTTCCGTGCATC
>probe:Drosophila_2:1636029_s_at:666:575; Interrogation_Position=463; Antisense; GGCCCTGCGAAAGGTCTACGACCAA
>probe:Drosophila_2:1636029_s_at:212:167; Interrogation_Position=486; Antisense; AAATGCCCGAGCCACGTTGGGTCAT
>probe:Drosophila_2:1636029_s_at:433:727; Interrogation_Position=502; Antisense; TTGGGTCATCTCCATGGGCAGCTGT
>probe:Drosophila_2:1636029_s_at:564:195; Interrogation_Position=530; Antisense; AACGGCGGCGGCTACTACCATTACT
>probe:Drosophila_2:1636029_s_at:249:519; Interrogation_Position=570; Antisense; GTGGCTGCGATAGGATAATCCCCGT
>probe:Drosophila_2:1636029_s_at:219:291; Interrogation_Position=592; Antisense; CGTCGACATATACGTACCCGGTTGT
>probe:Drosophila_2:1636029_s_at:139:601; Interrogation_Position=639; Antisense; TGTACGGCGTTTTGCAGCTGCAGAA
>probe:Drosophila_2:1636029_s_at:213:173; Interrogation_Position=748; Antisense; AAACGACATACGATTTTGCGAACAG

Paste this into a BLAST search page for me
GGTCGCAAGGGCTCGATCTGGCCACATCTGGCCACTGACTTTCGGTTTGGGGTTTGGCCTGCTGTGCCGTCGAAAGAAATGATGCACATCGCTGCTCCGCTGCTCCGCGTTACGACATGGATCGAGATATGGTGTTGTGTTCCGTGCATCGGCCCTGCGAAAGGTCTACGACCAAAAATGCCCGAGCCACGTTGGGTCATTTGGGTCATCTCCATGGGCAGCTGTAACGGCGGCGGCTACTACCATTACTGTGGCTGCGATAGGATAATCCCCGTCGTCGACATATACGTACCCGGTTGTTGTACGGCGTTTTGCAGCTGCAGAAAAACGACATACGATTTTGCGAACAG

Full Affymetrix probeset data:

Annotations for 1636029_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime