Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636030_s_at:

>probe:Drosophila_2:1636030_s_at:229:701; Interrogation_Position=105; Antisense; TTTTTTGCCATGAACTTCAATCGCA
>probe:Drosophila_2:1636030_s_at:723:383; Interrogation_Position=116; Antisense; GAACTTCAATCGCATGGATACCGCC
>probe:Drosophila_2:1636030_s_at:511:65; Interrogation_Position=129; Antisense; ATGGATACCGCCCATCGGTTGCGCG
>probe:Drosophila_2:1636030_s_at:630:277; Interrogation_Position=13; Antisense; CTCTCGAACAAGTTACTTCACAACA
>probe:Drosophila_2:1636030_s_at:459:469; Interrogation_Position=146; Antisense; GTTGCGCGTCGATGTTCGACTTTAT
>probe:Drosophila_2:1636030_s_at:606:525; Interrogation_Position=173; Antisense; GGGATCGATGGGAAATCAGCTAAAT
>probe:Drosophila_2:1636030_s_at:375:117; Interrogation_Position=190; Antisense; AGCTAAATGACAAAGGCACCGCCTC
>probe:Drosophila_2:1636030_s_at:687:129; Interrogation_Position=225; Antisense; ACCATTTCATCGGACGATCTCAGTG
>probe:Drosophila_2:1636030_s_at:326:289; Interrogation_Position=235; Antisense; CGGACGATCTCAGTGATCTCGCCGA
>probe:Drosophila_2:1636030_s_at:498:473; Interrogation_Position=24; Antisense; GTTACTTCACAACACAACCTTGTCT
>probe:Drosophila_2:1636030_s_at:68:203; Interrogation_Position=39; Antisense; AACCTTGTCTACGATCCTCCGATTT
>probe:Drosophila_2:1636030_s_at:371:459; Interrogation_Position=59; Antisense; GATTTCCCGGGTTTTCTCTGCATTT
>probe:Drosophila_2:1636030_s_at:142:541; Interrogation_Position=68; Antisense; GGTTTTCTCTGCATTTTCTGTACAC
>probe:Drosophila_2:1636030_s_at:199:345; Interrogation_Position=78; Antisense; GCATTTTCTGTACACTTTTTCATTT

Paste this into a BLAST search page for me
TTTTTTGCCATGAACTTCAATCGCAGAACTTCAATCGCATGGATACCGCCATGGATACCGCCCATCGGTTGCGCGCTCTCGAACAAGTTACTTCACAACAGTTGCGCGTCGATGTTCGACTTTATGGGATCGATGGGAAATCAGCTAAATAGCTAAATGACAAAGGCACCGCCTCACCATTTCATCGGACGATCTCAGTGCGGACGATCTCAGTGATCTCGCCGAGTTACTTCACAACACAACCTTGTCTAACCTTGTCTACGATCCTCCGATTTGATTTCCCGGGTTTTCTCTGCATTTGGTTTTCTCTGCATTTTCTGTACACGCATTTTCTGTACACTTTTTCATTT

Full Affymetrix probeset data:

Annotations for 1636030_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime