FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636032_at:

>probe:Drosophila_2:1636032_at:498:583; Interrogation_Position=4746; Antisense; TGGCTTCCGTTTTATCACCGATCAT
>probe:Drosophila_2:1636032_at:345:547; Interrogation_Position=4781; Antisense; GGATGACCCTGAAGATACCGTCTTT
>probe:Drosophila_2:1636032_at:135:251; Interrogation_Position=4812; Antisense; CAAGACTTTAATATCCGCGGGACAG
>probe:Drosophila_2:1636032_at:72:21; Interrogation_Position=4848; Antisense; ATTTGATGCTCTCTTGAAGGCTCCC
>probe:Drosophila_2:1636032_at:275:307; Interrogation_Position=4900; Antisense; GCCTTTTTAGCCGATCACTTGGTTA
>probe:Drosophila_2:1636032_at:237:569; Interrogation_Position=4925; Antisense; GGCATCGGAAACATCGCAATCAGCT
>probe:Drosophila_2:1636032_at:126:25; Interrogation_Position=4979; Antisense; ATATGCTTTGCATGTACTTTCCACA
>probe:Drosophila_2:1636032_at:703:627; Interrogation_Position=5008; Antisense; TCCTATTTCGCCTGGGAGATCAATA
>probe:Drosophila_2:1636032_at:285:487; Interrogation_Position=5051; Antisense; GTAGCTTTGGCATTTTCCAGCACCA
>probe:Drosophila_2:1636032_at:595:673; Interrogation_Position=5162; Antisense; TAGCCACTGGATTTGCTGAGTCCAT
>probe:Drosophila_2:1636032_at:460:57; Interrogation_Position=5185; Antisense; ATGAGCTTCGTTGTGGCAGCACTTA
>probe:Drosophila_2:1636032_at:5:529; Interrogation_Position=5220; Antisense; GGGAGCACTCTGTATTTCCATTGTG
>probe:Drosophila_2:1636032_at:35:499; Interrogation_Position=5245; Antisense; GTCTTTGGTCTGGAGTTGCTGAGTC
>probe:Drosophila_2:1636032_at:59:499; Interrogation_Position=5267; Antisense; GTCGAAGACGCCACTGGACGGGATT

Paste this into a BLAST search page for me
TGGCTTCCGTTTTATCACCGATCATGGATGACCCTGAAGATACCGTCTTTCAAGACTTTAATATCCGCGGGACAGATTTGATGCTCTCTTGAAGGCTCCCGCCTTTTTAGCCGATCACTTGGTTAGGCATCGGAAACATCGCAATCAGCTATATGCTTTGCATGTACTTTCCACATCCTATTTCGCCTGGGAGATCAATAGTAGCTTTGGCATTTTCCAGCACCATAGCCACTGGATTTGCTGAGTCCATATGAGCTTCGTTGTGGCAGCACTTAGGGAGCACTCTGTATTTCCATTGTGGTCTTTGGTCTGGAGTTGCTGAGTCGTCGAAGACGCCACTGGACGGGATT

Full Affymetrix probeset data:

Annotations for 1636032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720