FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636033_at:

>probe:Drosophila_2:1636033_at:11:25; Interrogation_Position=4024; Antisense; ATATGTATTTGGCAGGGTCTCCTTG
>probe:Drosophila_2:1636033_at:552:529; Interrogation_Position=4038; Antisense; GGGTCTCCTTGTTTAAGAACTGTCT
>probe:Drosophila_2:1636033_at:306:561; Interrogation_Position=4063; Antisense; GGAACTTCAGCAGACTTTCAAGCTT
>probe:Drosophila_2:1636033_at:684:207; Interrogation_Position=4082; Antisense; AAGCTTCTAACACAGAGACCTTTGA
>probe:Drosophila_2:1636033_at:279:645; Interrogation_Position=4102; Antisense; TTTGAAGTTGAGTCTGGTACCCGAA
>probe:Drosophila_2:1636033_at:449:105; Interrogation_Position=4126; Antisense; AGACAAGTTCCCCACGGATCGTTTG
>probe:Drosophila_2:1636033_at:515:545; Interrogation_Position=4141; Antisense; GGATCGTTTGGCTAGTGCTGCTGTA
>probe:Drosophila_2:1636033_at:148:87; Interrogation_Position=4154; Antisense; AGTGCTGCTGTAGCCAGTCAAGATA
>probe:Drosophila_2:1636033_at:603:661; Interrogation_Position=4251; Antisense; TAAAGGGCACTCTTCCTTCCGAAGA
>probe:Drosophila_2:1636033_at:268:467; Interrogation_Position=4279; Antisense; GTTGGAAGCAATGCGCAACCAGCTG
>probe:Drosophila_2:1636033_at:516:375; Interrogation_Position=4331; Antisense; GAAGCTTCCGAAGAGCCTCCGGAAA
>probe:Drosophila_2:1636033_at:128:105; Interrogation_Position=4495; Antisense; AGACAAAACCCAGGAGTCGGCTCCA
>probe:Drosophila_2:1636033_at:670:87; Interrogation_Position=4509; Antisense; AGTCGGCTCCAGCTGAAGAGTCTTA
>probe:Drosophila_2:1636033_at:284:497; Interrogation_Position=4528; Antisense; GTCTTAGTTATTGTTCAGTTGCTCA

Paste this into a BLAST search page for me
ATATGTATTTGGCAGGGTCTCCTTGGGGTCTCCTTGTTTAAGAACTGTCTGGAACTTCAGCAGACTTTCAAGCTTAAGCTTCTAACACAGAGACCTTTGATTTGAAGTTGAGTCTGGTACCCGAAAGACAAGTTCCCCACGGATCGTTTGGGATCGTTTGGCTAGTGCTGCTGTAAGTGCTGCTGTAGCCAGTCAAGATATAAAGGGCACTCTTCCTTCCGAAGAGTTGGAAGCAATGCGCAACCAGCTGGAAGCTTCCGAAGAGCCTCCGGAAAAGACAAAACCCAGGAGTCGGCTCCAAGTCGGCTCCAGCTGAAGAGTCTTAGTCTTAGTTATTGTTCAGTTGCTCA

Full Affymetrix probeset data:

Annotations for 1636033_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720