Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636034_at:

>probe:Drosophila_2:1636034_at:163:319; Interrogation_Position=10001; Antisense; GCCGATCCTCATGCATTCAATCAGT
>probe:Drosophila_2:1636034_at:263:307; Interrogation_Position=10007; Antisense; CCTCATGCATTCAATCAGTCAGTCA
>probe:Drosophila_2:1636034_at:80:495; Interrogation_Position=10036; Antisense; GTCAATCAGCCCGTCATTGCTAAAT
>probe:Drosophila_2:1636034_at:121:321; Interrogation_Position=10044; Antisense; GCCCGTCATTGCTAAATTGATCTCA
>probe:Drosophila_2:1636034_at:694:5; Interrogation_Position=10059; Antisense; ATTGATCTCAATTTCTGTCGATTGG
>probe:Drosophila_2:1636034_at:28:715; Interrogation_Position=10071; Antisense; TTCTGTCGATTGGTTTTGCAGCCAT
>probe:Drosophila_2:1636034_at:232:3; Interrogation_Position=10079; Antisense; ATTGGTTTTGCAGCCATGAGCGATC
>probe:Drosophila_2:1636034_at:347:239; Interrogation_Position=9914; Antisense; AATCAAACACCTTCAACTCAGTCAA
>probe:Drosophila_2:1636034_at:62:129; Interrogation_Position=9922; Antisense; ACCTTCAACTCAGTCAAAAGTCAAT
>probe:Drosophila_2:1636034_at:75:219; Interrogation_Position=9939; Antisense; AAGTCAATCAATCTGATCCTTTCGA
>probe:Drosophila_2:1636034_at:673:235; Interrogation_Position=9948; Antisense; AATCTGATCCTTTCGAATATCAAGA
>probe:Drosophila_2:1636034_at:208:363; Interrogation_Position=9962; Antisense; GAATATCAAGATCGAACAAATTTCA
>probe:Drosophila_2:1636034_at:206:245; Interrogation_Position=9980; Antisense; AATTTCAATAGCTCATCTCACGCCG
>probe:Drosophila_2:1636034_at:22:699; Interrogation_Position=9982; Antisense; TTTCAATAGCTCATCTCACGCCGAT

Paste this into a BLAST search page for me
GCCGATCCTCATGCATTCAATCAGTCCTCATGCATTCAATCAGTCAGTCAGTCAATCAGCCCGTCATTGCTAAATGCCCGTCATTGCTAAATTGATCTCAATTGATCTCAATTTCTGTCGATTGGTTCTGTCGATTGGTTTTGCAGCCATATTGGTTTTGCAGCCATGAGCGATCAATCAAACACCTTCAACTCAGTCAAACCTTCAACTCAGTCAAAAGTCAATAAGTCAATCAATCTGATCCTTTCGAAATCTGATCCTTTCGAATATCAAGAGAATATCAAGATCGAACAAATTTCAAATTTCAATAGCTCATCTCACGCCGTTTCAATAGCTCATCTCACGCCGAT

Full Affymetrix probeset data:

Annotations for 1636034_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime