FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636035_at:

>probe:Drosophila_2:1636035_at:26:711; Interrogation_Position=2428; Antisense; TTCATTAGCCATTAGTTCAACGTTT
>probe:Drosophila_2:1636035_at:564:179; Interrogation_Position=2460; Antisense; AAACAGGTCTAGAGAATACCCTCAT
>probe:Drosophila_2:1636035_at:653:27; Interrogation_Position=2475; Antisense; ATACCCTCATTTCGTTGATTTCAAG
>probe:Drosophila_2:1636035_at:70:483; Interrogation_Position=2499; Antisense; GTATTTTCGTTTGATGACTGCTTTT
>probe:Drosophila_2:1636035_at:446:403; Interrogation_Position=2514; Antisense; GACTGCTTTTCATGTTAACTCTTAT
>probe:Drosophila_2:1636035_at:110:159; Interrogation_Position=2554; Antisense; ACACTTTGAGATGTGGCGTCTACTA
>probe:Drosophila_2:1636035_at:101:65; Interrogation_Position=2564; Antisense; ATGTGGCGTCTACTAGCGAGCTAAA
>probe:Drosophila_2:1636035_at:426:357; Interrogation_Position=2612; Antisense; GCAAACATTTATAAACTAGCCTAGT
>probe:Drosophila_2:1636035_at:435:241; Interrogation_Position=2647; Antisense; AATACTGGAGGTTGGACAGCAGAAC
>probe:Drosophila_2:1636035_at:487:173; Interrogation_Position=2691; Antisense; AAAGCAGGACATACACAATTCAAAT
>probe:Drosophila_2:1636035_at:456:669; Interrogation_Position=2773; Antisense; TACTGATTCTACTTTTAATGTGCAA
>probe:Drosophila_2:1636035_at:35:421; Interrogation_Position=2817; Antisense; GAGCAGCATAACAAACCAAAGCCAG
>probe:Drosophila_2:1636035_at:728:237; Interrogation_Position=2843; Antisense; AATCAAAGGTGTGTATCCGAGGGAA
>probe:Drosophila_2:1636035_at:125:255; Interrogation_Position=2933; Antisense; CAAAGCCTTGTATGGGCATATTGTA

Paste this into a BLAST search page for me
TTCATTAGCCATTAGTTCAACGTTTAAACAGGTCTAGAGAATACCCTCATATACCCTCATTTCGTTGATTTCAAGGTATTTTCGTTTGATGACTGCTTTTGACTGCTTTTCATGTTAACTCTTATACACTTTGAGATGTGGCGTCTACTAATGTGGCGTCTACTAGCGAGCTAAAGCAAACATTTATAAACTAGCCTAGTAATACTGGAGGTTGGACAGCAGAACAAAGCAGGACATACACAATTCAAATTACTGATTCTACTTTTAATGTGCAAGAGCAGCATAACAAACCAAAGCCAGAATCAAAGGTGTGTATCCGAGGGAACAAAGCCTTGTATGGGCATATTGTA

Full Affymetrix probeset data:

Annotations for 1636035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720