FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636036_at:

>probe:Drosophila_2:1636036_at:284:303; Interrogation_Position=1037; Antisense; CCGCCTGGATTTGTTTGTTCCACAA
>probe:Drosophila_2:1636036_at:134:481; Interrogation_Position=1049; Antisense; GTTTGTTCCACAACCTTTGATTAAG
>probe:Drosophila_2:1636036_at:389:409; Interrogation_Position=1082; Antisense; GACGCATGTGTTTAGCATTACCCTA
>probe:Drosophila_2:1636036_at:618:553; Interrogation_Position=1111; Antisense; GGACGGGTTTGCACATTATGCACTT
>probe:Drosophila_2:1636036_at:270:609; Interrogation_Position=743; Antisense; TGAGCGCCCTCATGGGAGAGTCCTC
>probe:Drosophila_2:1636036_at:59:223; Interrogation_Position=811; Antisense; AAGGAGCGCGATTTGTACGACCCCA
>probe:Drosophila_2:1636036_at:547:107; Interrogation_Position=836; Antisense; AGAACAAGCAGTTCGCCATTTGCGA
>probe:Drosophila_2:1636036_at:694:299; Interrogation_Position=849; Antisense; CGCCATTTGCGACGACGAGCTGATG
>probe:Drosophila_2:1636036_at:176:615; Interrogation_Position=872; Antisense; TGAAGGTGATGAAGATCCGCCGCTT
>probe:Drosophila_2:1636036_at:651:303; Interrogation_Position=897; Antisense; CCGCACCTTTGGCATGCTGAAGCAT
>probe:Drosophila_2:1636036_at:546:621; Interrogation_Position=911; Antisense; TGCTGAAGCATCTCAAGCCGCACTT
>probe:Drosophila_2:1636036_at:68:125; Interrogation_Position=926; Antisense; AGCCGCACTTTCTCGATTAGATCAG
>probe:Drosophila_2:1636036_at:200:633; Interrogation_Position=959; Antisense; TCCGATCCTCTCCAGATGCAAATAT
>probe:Drosophila_2:1636036_at:629:243; Interrogation_Position=979; Antisense; AATATATGTGTATGCCTCTCCGCCA

Paste this into a BLAST search page for me
CCGCCTGGATTTGTTTGTTCCACAAGTTTGTTCCACAACCTTTGATTAAGGACGCATGTGTTTAGCATTACCCTAGGACGGGTTTGCACATTATGCACTTTGAGCGCCCTCATGGGAGAGTCCTCAAGGAGCGCGATTTGTACGACCCCAAGAACAAGCAGTTCGCCATTTGCGACGCCATTTGCGACGACGAGCTGATGTGAAGGTGATGAAGATCCGCCGCTTCCGCACCTTTGGCATGCTGAAGCATTGCTGAAGCATCTCAAGCCGCACTTAGCCGCACTTTCTCGATTAGATCAGTCCGATCCTCTCCAGATGCAAATATAATATATGTGTATGCCTCTCCGCCA

Full Affymetrix probeset data:

Annotations for 1636036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720