FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636037_at:

>probe:Drosophila_2:1636037_at:506:651; Interrogation_Position=2302; Antisense; TCAAGGGTGTGGTAGCTGTCTCCAT
>probe:Drosophila_2:1636037_at:562:395; Interrogation_Position=2361; Antisense; GACTGGTACTACGAACCGAACGCCT
>probe:Drosophila_2:1636037_at:484:719; Interrogation_Position=2428; Antisense; TTCCCATTATGGGTCGTGGCTATGA
>probe:Drosophila_2:1636037_at:338:629; Interrogation_Position=2441; Antisense; TCGTGGCTATGAAACCGGAGGCTAC
>probe:Drosophila_2:1636037_at:469:665; Interrogation_Position=2463; Antisense; TACAAGTGCGAGTGCCTGCAGGGAT
>probe:Drosophila_2:1636037_at:237:437; Interrogation_Position=2502; Antisense; GAGGATCTGATTACCTACTACGATG
>probe:Drosophila_2:1636037_at:55:67; Interrogation_Position=2524; Antisense; ATGGACAGCTCGTCGAGGCCGAGTA
>probe:Drosophila_2:1636037_at:76:691; Interrogation_Position=2555; Antisense; TATTGTGGCTGATGTCGAGACCCGC
>probe:Drosophila_2:1636037_at:24:425; Interrogation_Position=2571; Antisense; GAGACCCGCTACGATATGTTCAAGT
>probe:Drosophila_2:1636037_at:726:457; Interrogation_Position=2583; Antisense; GATATGTTCAAGTGCCGACTGGCCG
>probe:Drosophila_2:1636037_at:547:615; Interrogation_Position=2620; Antisense; TGCAATCCGCTTTGGGACTTGTGGT
>probe:Drosophila_2:1636037_at:642:297; Interrogation_Position=2662; Antisense; CGCTCACCCTGCTGTATAGATTTAG
>probe:Drosophila_2:1636037_at:208:461; Interrogation_Position=2680; Antisense; GATTTAGTTAAGCACCGCACGCCAA
>probe:Drosophila_2:1636037_at:239:469; Interrogation_Position=2839; Antisense; GTTGCTCCCTTTGAACATTGTCATC

Paste this into a BLAST search page for me
TCAAGGGTGTGGTAGCTGTCTCCATGACTGGTACTACGAACCGAACGCCTTTCCCATTATGGGTCGTGGCTATGATCGTGGCTATGAAACCGGAGGCTACTACAAGTGCGAGTGCCTGCAGGGATGAGGATCTGATTACCTACTACGATGATGGACAGCTCGTCGAGGCCGAGTATATTGTGGCTGATGTCGAGACCCGCGAGACCCGCTACGATATGTTCAAGTGATATGTTCAAGTGCCGACTGGCCGTGCAATCCGCTTTGGGACTTGTGGTCGCTCACCCTGCTGTATAGATTTAGGATTTAGTTAAGCACCGCACGCCAAGTTGCTCCCTTTGAACATTGTCATC

Full Affymetrix probeset data:

Annotations for 1636037_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720