FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636038_at:

>probe:Drosophila_2:1636038_at:729:91; Interrogation_Position=505; Antisense; AGTTCAACGACAGCGATATCGGCGT
>probe:Drosophila_2:1636038_at:597:21; Interrogation_Position=520; Antisense; ATATCGGCGTGGAGGACTTTCTGGA
>probe:Drosophila_2:1636038_at:670:683; Interrogation_Position=557; Antisense; TATCCGGAGGACCATGCACCTGCGT
>probe:Drosophila_2:1636038_at:424:621; Interrogation_Position=577; Antisense; TGCGTCGCCTCAAGGCCGAAAAAAT
>probe:Drosophila_2:1636038_at:398:707; Interrogation_Position=647; Antisense; TTCTCTGCCAGCCTACGGAAACGTG
>probe:Drosophila_2:1636038_at:347:177; Interrogation_Position=665; Antisense; AAACGTGCCCTCCAGCGGATTCTAT
>probe:Drosophila_2:1636038_at:24:131; Interrogation_Position=758; Antisense; ACCGTACTGAGGTCTTGGTCCTTGG
>probe:Drosophila_2:1636038_at:507:591; Interrogation_Position=780; Antisense; TGGTCCTTGGTCCTCAGCGAATTAA
>probe:Drosophila_2:1636038_at:18:629; Interrogation_Position=806; Antisense; TGCCATGGCGCATCAGTCTGCAGCA
>probe:Drosophila_2:1636038_at:299:347; Interrogation_Position=828; Antisense; GCAGGCAAAATCCTCTCTTTAAGTA
>probe:Drosophila_2:1636038_at:453:489; Interrogation_Position=850; Antisense; GTACATATTGCTTCAGTTTCATCTT
>probe:Drosophila_2:1636038_at:214:479; Interrogation_Position=865; Antisense; GTTTCATCTTCTGATTACAGTGGGT
>probe:Drosophila_2:1636038_at:491:527; Interrogation_Position=905; Antisense; GGGAACTTTCTGGTACACACATCTC
>probe:Drosophila_2:1636038_at:517:643; Interrogation_Position=926; Antisense; TCTCTGCCTGCACTAAACTATGATA

Paste this into a BLAST search page for me
AGTTCAACGACAGCGATATCGGCGTATATCGGCGTGGAGGACTTTCTGGATATCCGGAGGACCATGCACCTGCGTTGCGTCGCCTCAAGGCCGAAAAAATTTCTCTGCCAGCCTACGGAAACGTGAAACGTGCCCTCCAGCGGATTCTATACCGTACTGAGGTCTTGGTCCTTGGTGGTCCTTGGTCCTCAGCGAATTAATGCCATGGCGCATCAGTCTGCAGCAGCAGGCAAAATCCTCTCTTTAAGTAGTACATATTGCTTCAGTTTCATCTTGTTTCATCTTCTGATTACAGTGGGTGGGAACTTTCTGGTACACACATCTCTCTCTGCCTGCACTAAACTATGATA

Full Affymetrix probeset data:

Annotations for 1636038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720