FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636040_at:

>probe:Drosophila_2:1636040_at:361:655; Interrogation_Position=1004; Antisense; TAATCTGAGCGCTTTACAGTTCAAC
>probe:Drosophila_2:1636040_at:535:341; Interrogation_Position=1014; Antisense; GCTTTACAGTTCAACTGGTCGCAGA
>probe:Drosophila_2:1636040_at:152:23; Interrogation_Position=1054; Antisense; ATATGTGCATTTCTACTCAAAACTG
>probe:Drosophila_2:1636040_at:185:243; Interrogation_Position=1175; Antisense; AATAGGCACTTATTTGCATTCATTA
>probe:Drosophila_2:1636040_at:369:511; Interrogation_Position=1288; Antisense; GTGAATCTAACAGTTCTATCGCAAT
>probe:Drosophila_2:1636040_at:282:473; Interrogation_Position=1300; Antisense; GTTCTATCGCAATCATTAATCACCT
>probe:Drosophila_2:1636040_at:103:655; Interrogation_Position=1316; Antisense; TAATCACCTTTTAATCCATTTGTAC
>probe:Drosophila_2:1636040_at:638:387; Interrogation_Position=1435; Antisense; GAAAATAATTTACTCCCACTCAATG
>probe:Drosophila_2:1636040_at:1:547; Interrogation_Position=883; Antisense; GGATGCTGCTACATTCCGTACGGCG
>probe:Drosophila_2:1636040_at:427:339; Interrogation_Position=890; Antisense; GCTACATTCCGTACGGCGGCGAGGA
>probe:Drosophila_2:1636040_at:22:121; Interrogation_Position=914; Antisense; AGCTGGCCTACAAGGAGTTCGAAAT
>probe:Drosophila_2:1636040_at:374:75; Interrogation_Position=926; Antisense; AGGAGTTCGAAATCTATGTGACCAA
>probe:Drosophila_2:1636040_at:659:595; Interrogation_Position=942; Antisense; TGTGACCAACTAAGCCACGGATCGA
>probe:Drosophila_2:1636040_at:209:451; Interrogation_Position=961; Antisense; GATCGAATGTCCAACGCACTGAAAC

Paste this into a BLAST search page for me
TAATCTGAGCGCTTTACAGTTCAACGCTTTACAGTTCAACTGGTCGCAGAATATGTGCATTTCTACTCAAAACTGAATAGGCACTTATTTGCATTCATTAGTGAATCTAACAGTTCTATCGCAATGTTCTATCGCAATCATTAATCACCTTAATCACCTTTTAATCCATTTGTACGAAAATAATTTACTCCCACTCAATGGGATGCTGCTACATTCCGTACGGCGGCTACATTCCGTACGGCGGCGAGGAAGCTGGCCTACAAGGAGTTCGAAATAGGAGTTCGAAATCTATGTGACCAATGTGACCAACTAAGCCACGGATCGAGATCGAATGTCCAACGCACTGAAAC

Full Affymetrix probeset data:

Annotations for 1636040_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720