FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636042_at:

>probe:Drosophila_2:1636042_at:74:81; Interrogation_Position=571; Antisense; AGGGAATTATCCTGTCGTTGGCCAC
>probe:Drosophila_2:1636042_at:404:357; Interrogation_Position=603; Antisense; GCAAAAGCCGCAGTTTTCCGACCAA
>probe:Drosophila_2:1636042_at:33:415; Interrogation_Position=622; Antisense; GACCAACAGGCCCATCGAGTGAAAG
>probe:Drosophila_2:1636042_at:392:387; Interrogation_Position=651; Antisense; GAAAAGGCGCTATAATGACCTACAT
>probe:Drosophila_2:1636042_at:424:411; Interrogation_Position=667; Antisense; GACCTACATTATTTGTTTGTTCGCA
>probe:Drosophila_2:1636042_at:454:15; Interrogation_Position=701; Antisense; ATTTTGGAGGCAGCCTTCTGACCAT
>probe:Drosophila_2:1636042_at:613:413; Interrogation_Position=720; Antisense; GACCATCATCATTGTTCACTTTGCG
>probe:Drosophila_2:1636042_at:696:147; Interrogation_Position=737; Antisense; ACTTTGCGATCTTTGTTTCCAACTC
>probe:Drosophila_2:1636042_at:117:481; Interrogation_Position=751; Antisense; GTTTCCAACTCCTATTGGCTATTCG
>probe:Drosophila_2:1636042_at:718:411; Interrogation_Position=791; Antisense; GACCCTGGAGGATATATGCCATCTT
>probe:Drosophila_2:1636042_at:128:49; Interrogation_Position=806; Antisense; ATGCCATCTTGCTCAACTTGGGATT
>probe:Drosophila_2:1636042_at:295:601; Interrogation_Position=840; Antisense; TGTAGCCCTGCAAATGGCAGCTGCT
>probe:Drosophila_2:1636042_at:62:569; Interrogation_Position=855; Antisense; GGCAGCTGCTTGTTGGCACTGTCAA
>probe:Drosophila_2:1636042_at:507:171; Interrogation_Position=881; Antisense; AAAGCTATAATCTAGGCCGGCAAAT

Paste this into a BLAST search page for me
AGGGAATTATCCTGTCGTTGGCCACGCAAAAGCCGCAGTTTTCCGACCAAGACCAACAGGCCCATCGAGTGAAAGGAAAAGGCGCTATAATGACCTACATGACCTACATTATTTGTTTGTTCGCAATTTTGGAGGCAGCCTTCTGACCATGACCATCATCATTGTTCACTTTGCGACTTTGCGATCTTTGTTTCCAACTCGTTTCCAACTCCTATTGGCTATTCGGACCCTGGAGGATATATGCCATCTTATGCCATCTTGCTCAACTTGGGATTTGTAGCCCTGCAAATGGCAGCTGCTGGCAGCTGCTTGTTGGCACTGTCAAAAAGCTATAATCTAGGCCGGCAAAT

Full Affymetrix probeset data:

Annotations for 1636042_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720