Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636046_at:

>probe:Drosophila_2:1636046_at:703:115; Interrogation_Position=1350; Antisense; AGCTTCGCGATGTCAGCCAAATTGA
>probe:Drosophila_2:1636046_at:519:243; Interrogation_Position=1421; Antisense; AATATCTGGCAGACGTGTGCGCTGC
>probe:Drosophila_2:1636046_at:343:625; Interrogation_Position=1443; Antisense; TGCCCTTCAAGATTCCCGAACAGAA
>probe:Drosophila_2:1636046_at:172:387; Interrogation_Position=1460; Antisense; GAACAGAATCTGACGGATACGCGCT
>probe:Drosophila_2:1636046_at:325:457; Interrogation_Position=1475; Antisense; GATACGCGCTATATGGAGACCTGTC
>probe:Drosophila_2:1636046_at:172:425; Interrogation_Position=1490; Antisense; GAGACCTGTCGGGAATGCCCTAATG
>probe:Drosophila_2:1636046_at:649:231; Interrogation_Position=1503; Antisense; AATGCCCTAATGTGTATCCCTGGCT
>probe:Drosophila_2:1636046_at:69:31; Interrogation_Position=1563; Antisense; ATAACTATATCTTTGCCGGTGGCGA
>probe:Drosophila_2:1636046_at:397:695; Interrogation_Position=1633; Antisense; TTTCACTCTATCCAACCCATAAATT
>probe:Drosophila_2:1636046_at:302:701; Interrogation_Position=1671; Antisense; TTTTTATTTTGTGCCTCTCTGACTC
>probe:Drosophila_2:1636046_at:530:461; Interrogation_Position=1713; Antisense; GATTTTCCTCTATAGTGTACGCTTA
>probe:Drosophila_2:1636046_at:117:489; Interrogation_Position=1729; Antisense; GTACGCTTAGTAATTTCCCACACAT
>probe:Drosophila_2:1636046_at:601:257; Interrogation_Position=1747; Antisense; CACACATGTGCCAGTCATCGTGATG
>probe:Drosophila_2:1636046_at:512:661; Interrogation_Position=1805; Antisense; TAAATATCTCCTTGTTCCTTCTTCT

Paste this into a BLAST search page for me
AGCTTCGCGATGTCAGCCAAATTGAAATATCTGGCAGACGTGTGCGCTGCTGCCCTTCAAGATTCCCGAACAGAAGAACAGAATCTGACGGATACGCGCTGATACGCGCTATATGGAGACCTGTCGAGACCTGTCGGGAATGCCCTAATGAATGCCCTAATGTGTATCCCTGGCTATAACTATATCTTTGCCGGTGGCGATTTCACTCTATCCAACCCATAAATTTTTTTATTTTGTGCCTCTCTGACTCGATTTTCCTCTATAGTGTACGCTTAGTACGCTTAGTAATTTCCCACACATCACACATGTGCCAGTCATCGTGATGTAAATATCTCCTTGTTCCTTCTTCT

Full Affymetrix probeset data:

Annotations for 1636046_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime