FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636048_at:

>probe:Drosophila_2:1636048_at:661:165; Interrogation_Position=153; Antisense; AAATGAAATGTGTGCGCCGGAGATC
>probe:Drosophila_2:1636048_at:338:159; Interrogation_Position=254; Antisense; ACAAGAACGATTTCCGAGCGGTGGT
>probe:Drosophila_2:1636048_at:653:417; Interrogation_Position=269; Antisense; GAGCGGTGGTGCACTCCATGGAACT
>probe:Drosophila_2:1636048_at:4:427; Interrogation_Position=295; Antisense; GAGAGGGTGCGCTACATAATGGCCA
>probe:Drosophila_2:1636048_at:59:33; Interrogation_Position=310; Antisense; ATAATGGCCAGTTATCTGCGTTGCC
>probe:Drosophila_2:1636048_at:660:97; Interrogation_Position=344; Antisense; AGATCGAAACCTTCACGCAGCACAT
>probe:Drosophila_2:1636048_at:543:53; Interrogation_Position=398; Antisense; ATGACAAACGTCTGTCTCCCGAGGA
>probe:Drosophila_2:1636048_at:263:91; Interrogation_Position=428; Antisense; AGTTCGCCCAGGAGTTTGCCAGTAA
>probe:Drosophila_2:1636048_at:633:289; Interrogation_Position=515; Antisense; CGGAGCAGAGGATTGTGACGCCCAA
>probe:Drosophila_2:1636048_at:33:611; Interrogation_Position=530; Antisense; TGACGCCCAATCTGATGAGCCATGT
>probe:Drosophila_2:1636048_at:170:57; Interrogation_Position=544; Antisense; ATGAGCCATGTCTTTCTTAAGGCAA
>probe:Drosophila_2:1636048_at:711:167; Interrogation_Position=567; Antisense; AAATGTGGCAGTGCCCGCTGTGATC
>probe:Drosophila_2:1636048_at:259:257; Interrogation_Position=634; Antisense; CAGCATATTATTCCCTACCAACTAG
>probe:Drosophila_2:1636048_at:711:189; Interrogation_Position=653; Antisense; AACTAGTGGCCGACTTGATACAAAA

Paste this into a BLAST search page for me
AAATGAAATGTGTGCGCCGGAGATCACAAGAACGATTTCCGAGCGGTGGTGAGCGGTGGTGCACTCCATGGAACTGAGAGGGTGCGCTACATAATGGCCAATAATGGCCAGTTATCTGCGTTGCCAGATCGAAACCTTCACGCAGCACATATGACAAACGTCTGTCTCCCGAGGAAGTTCGCCCAGGAGTTTGCCAGTAACGGAGCAGAGGATTGTGACGCCCAATGACGCCCAATCTGATGAGCCATGTATGAGCCATGTCTTTCTTAAGGCAAAAATGTGGCAGTGCCCGCTGTGATCCAGCATATTATTCCCTACCAACTAGAACTAGTGGCCGACTTGATACAAAA

Full Affymetrix probeset data:

Annotations for 1636048_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720