Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636050_at:

>probe:Drosophila_2:1636050_at:224:249; Interrogation_Position=1406; Antisense; AATTGTGCGGCGGTTCTAATCTTAA
>probe:Drosophila_2:1636050_at:504:77; Interrogation_Position=1436; Antisense; AGGAGGAACTTCCACAGACCAGCAC
>probe:Drosophila_2:1636050_at:126:343; Interrogation_Position=1457; Antisense; GCACCAGGTTTAAAGCAAAGCCCAA
>probe:Drosophila_2:1636050_at:286:215; Interrogation_Position=1519; Antisense; CAAGCTAAACCCGTACATTCCAGTT
>probe:Drosophila_2:1636050_at:630:629; Interrogation_Position=1537; Antisense; TCCAGTTCCAGCGAATGCGAAGATT
>probe:Drosophila_2:1636050_at:445:387; Interrogation_Position=1633; Antisense; GAAAATATCTCCTATACTCTTGAAG
>probe:Drosophila_2:1636050_at:699:391; Interrogation_Position=1699; Antisense; GAAACCAAGGTGCAGGATTCGCAAT
>probe:Drosophila_2:1636050_at:485:717; Interrogation_Position=1716; Antisense; TTCGCAATACGATGACCTGGATGAT
>probe:Drosophila_2:1636050_at:193:1; Interrogation_Position=1800; Antisense; AAATTTGCAGTACAGGAACCCTCCT
>probe:Drosophila_2:1636050_at:530:611; Interrogation_Position=1824; Antisense; TGAACCGCCAAAAAGCCGACGCTAT
>probe:Drosophila_2:1636050_at:101:411; Interrogation_Position=1841; Antisense; GACGCTATGATCTACGCAACTCCAA
>probe:Drosophila_2:1636050_at:231:123; Interrogation_Position=1865; Antisense; AGCGAAATCCTCGTTGAGTCTGCCA
>probe:Drosophila_2:1636050_at:554:431; Interrogation_Position=1880; Antisense; GAGTCTGCCACTCATTGGAATTGTA
>probe:Drosophila_2:1636050_at:677:405; Interrogation_Position=1954; Antisense; GACTGTGTGGATTTGTGCACCAAAC

Paste this into a BLAST search page for me
AATTGTGCGGCGGTTCTAATCTTAAAGGAGGAACTTCCACAGACCAGCACGCACCAGGTTTAAAGCAAAGCCCAACAAGCTAAACCCGTACATTCCAGTTTCCAGTTCCAGCGAATGCGAAGATTGAAAATATCTCCTATACTCTTGAAGGAAACCAAGGTGCAGGATTCGCAATTTCGCAATACGATGACCTGGATGATAAATTTGCAGTACAGGAACCCTCCTTGAACCGCCAAAAAGCCGACGCTATGACGCTATGATCTACGCAACTCCAAAGCGAAATCCTCGTTGAGTCTGCCAGAGTCTGCCACTCATTGGAATTGTAGACTGTGTGGATTTGTGCACCAAAC

Full Affymetrix probeset data:

Annotations for 1636050_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime