FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636051_at:

>probe:Drosophila_2:1636051_at:229:75; Interrogation_Position=115; Antisense; AGGACATCAAGTTCTGGAGCGACGA
>probe:Drosophila_2:1636051_at:119:423; Interrogation_Position=138; Antisense; GAGAAGTTCGTCAGCCACAAGGTGG
>probe:Drosophila_2:1636051_at:256:297; Interrogation_Position=181; Antisense; CGCATCTGAACTTCTCCATGGAGGT
>probe:Drosophila_2:1636051_at:38:77; Interrogation_Position=211; Antisense; AGGAGCTGCACGACGTAGACATCCA
>probe:Drosophila_2:1636051_at:180:677; Interrogation_Position=226; Antisense; TAGACATCCACGTCGAGGTGCGCAT
>probe:Drosophila_2:1636051_at:206:411; Interrogation_Position=264; Antisense; GACCCGTACTACAACACTAATCTAA
>probe:Drosophila_2:1636051_at:74:663; Interrogation_Position=286; Antisense; TAAACACCACGCTGAATGTCTGCCG
>probe:Drosophila_2:1636051_at:516:593; Interrogation_Position=316; Antisense; TGGGCTTCGCCAACAAGTCACCGGT
>probe:Drosophila_2:1636051_at:99:463; Interrogation_Position=358; Antisense; GATTCATCCGCGAGTTCGGCAACAT
>probe:Drosophila_2:1636051_at:94:223; Interrogation_Position=405; Antisense; AAGGGCTCCTACTTCATCAACAAGT
>probe:Drosophila_2:1636051_at:112:121; Interrogation_Position=469; Antisense; AGCTGGAGTTCGAGATCATCTGGCA
>probe:Drosophila_2:1636051_at:677:39; Interrogation_Position=486; Antisense; ATCTGGCAGGCCATGCACGTGGACG
>probe:Drosophila_2:1636051_at:87:495; Interrogation_Position=573; Antisense; GTCAATAATCTGAAGCCCGGCATCT
>probe:Drosophila_2:1636051_at:68:233; Interrogation_Position=602; Antisense; AATGCTGCCCAAAATCGCCTAGAAG

Paste this into a BLAST search page for me
AGGACATCAAGTTCTGGAGCGACGAGAGAAGTTCGTCAGCCACAAGGTGGCGCATCTGAACTTCTCCATGGAGGTAGGAGCTGCACGACGTAGACATCCATAGACATCCACGTCGAGGTGCGCATGACCCGTACTACAACACTAATCTAATAAACACCACGCTGAATGTCTGCCGTGGGCTTCGCCAACAAGTCACCGGTGATTCATCCGCGAGTTCGGCAACATAAGGGCTCCTACTTCATCAACAAGTAGCTGGAGTTCGAGATCATCTGGCAATCTGGCAGGCCATGCACGTGGACGGTCAATAATCTGAAGCCCGGCATCTAATGCTGCCCAAAATCGCCTAGAAG

Full Affymetrix probeset data:

Annotations for 1636051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720