Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636052_at:

>probe:Drosophila_2:1636052_at:298:347; Interrogation_Position=2959; Antisense; GCATGAGCAATGTGTTCGCCGTGAA
>probe:Drosophila_2:1636052_at:688:317; Interrogation_Position=2976; Antisense; GCCGTGAACAGTCGCTTCGTGATAT
>probe:Drosophila_2:1636052_at:168:61; Interrogation_Position=2999; Antisense; ATGTACGCCGTCCACTCAGGAATAG
>probe:Drosophila_2:1636052_at:559:229; Interrogation_Position=3029; Antisense; AATGTCCATGCAATCGGTTTATCCC
>probe:Drosophila_2:1636052_at:545:539; Interrogation_Position=3044; Antisense; GGTTTATCCCAGTGTCCATACATCA
>probe:Drosophila_2:1636052_at:725:307; Interrogation_Position=3059; Antisense; CCATACATCATACCAAATCCCAAAT
>probe:Drosophila_2:1636052_at:526:649; Interrogation_Position=3095; Antisense; TCAGCACTCCATTCAGTTCAATTGC
>probe:Drosophila_2:1636052_at:536:687; Interrogation_Position=3224; Antisense; TATATCTCAAGCTTTGCCGTCAATC
>probe:Drosophila_2:1636052_at:505:573; Interrogation_Position=3253; Antisense; GGCTGCAAGCCATCAACTTAAGATA
>probe:Drosophila_2:1636052_at:257:473; Interrogation_Position=3350; Antisense; GTTCTATTTTGTTTGCGAATCCCAT
>probe:Drosophila_2:1636052_at:401:677; Interrogation_Position=3405; Antisense; TAGATTTTCGTAAGTGCATTTGCCA
>probe:Drosophila_2:1636052_at:476:345; Interrogation_Position=3420; Antisense; GCATTTGCCAATTGCCATGTTGTAA
>probe:Drosophila_2:1636052_at:556:477; Interrogation_Position=3511; Antisense; GTTTTAAACCGTAATGCGAGCTCGA
>probe:Drosophila_2:1636052_at:258:417; Interrogation_Position=3528; Antisense; GAGCTCGAAATAAACGCAACTTGCA

Paste this into a BLAST search page for me
GCATGAGCAATGTGTTCGCCGTGAAGCCGTGAACAGTCGCTTCGTGATATATGTACGCCGTCCACTCAGGAATAGAATGTCCATGCAATCGGTTTATCCCGGTTTATCCCAGTGTCCATACATCACCATACATCATACCAAATCCCAAATTCAGCACTCCATTCAGTTCAATTGCTATATCTCAAGCTTTGCCGTCAATCGGCTGCAAGCCATCAACTTAAGATAGTTCTATTTTGTTTGCGAATCCCATTAGATTTTCGTAAGTGCATTTGCCAGCATTTGCCAATTGCCATGTTGTAAGTTTTAAACCGTAATGCGAGCTCGAGAGCTCGAAATAAACGCAACTTGCA

Full Affymetrix probeset data:

Annotations for 1636052_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime