Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636053_s_at:

>probe:Drosophila_2:1636053_s_at:386:37; Interrogation_Position=129; Antisense; ATCATCATCTTCGTCAGCGTTTGGA
>probe:Drosophila_2:1636053_s_at:494:493; Interrogation_Position=141; Antisense; GTCAGCGTTTGGAAGTTTCGTCAGC
>probe:Drosophila_2:1636053_s_at:664:371; Interrogation_Position=152; Antisense; GAAGTTTCGTCAGCGAGGAACAGCT
>probe:Drosophila_2:1636053_s_at:577:87; Interrogation_Position=179; Antisense; AGTCCCAGGAGCATGTCTCATCCTC
>probe:Drosophila_2:1636053_s_at:204:177; Interrogation_Position=22; Antisense; AAACGTTATGCAACTCTGCTGGCCT
>probe:Drosophila_2:1636053_s_at:196:527; Interrogation_Position=247; Antisense; GGGCAATATCACCAGCAGCGCAGTG
>probe:Drosophila_2:1636053_s_at:653:121; Interrogation_Position=263; Antisense; AGCGCAGTGGCTCCGGATCCGTCAT
>probe:Drosophila_2:1636053_s_at:537:297; Interrogation_Position=305; Antisense; GCGGAGGACCTAGTGGACCCCAGAC
>probe:Drosophila_2:1636053_s_at:501:83; Interrogation_Position=316; Antisense; AGTGGACCCCAGACATATGCAAATG
>probe:Drosophila_2:1636053_s_at:598:361; Interrogation_Position=350; Antisense; GCAATGTGAATCTGCTGCTCGGCGG
>probe:Drosophila_2:1636053_s_at:691:283; Interrogation_Position=37; Antisense; CTGCTGGCCTTTGGTCAAAATCAGA
>probe:Drosophila_2:1636053_s_at:614:365; Interrogation_Position=60; Antisense; GAATCAGAATCACACAATCCCGGCC
>probe:Drosophila_2:1636053_s_at:240:235; Interrogation_Position=75; Antisense; AATCCCGGCCACAACAATATCGCTG
>probe:Drosophila_2:1636053_s_at:690:241; Interrogation_Position=90; Antisense; AATATCGCTGGTTTCCACAACGGAA

Paste this into a BLAST search page for me
ATCATCATCTTCGTCAGCGTTTGGAGTCAGCGTTTGGAAGTTTCGTCAGCGAAGTTTCGTCAGCGAGGAACAGCTAGTCCCAGGAGCATGTCTCATCCTCAAACGTTATGCAACTCTGCTGGCCTGGGCAATATCACCAGCAGCGCAGTGAGCGCAGTGGCTCCGGATCCGTCATGCGGAGGACCTAGTGGACCCCAGACAGTGGACCCCAGACATATGCAAATGGCAATGTGAATCTGCTGCTCGGCGGCTGCTGGCCTTTGGTCAAAATCAGAGAATCAGAATCACACAATCCCGGCCAATCCCGGCCACAACAATATCGCTGAATATCGCTGGTTTCCACAACGGAA

Full Affymetrix probeset data:

Annotations for 1636053_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime