FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636055_at:

>probe:Drosophila_2:1636055_at:246:81; Interrogation_Position=1635; Antisense; AGGTGGCCTTCGACTTGAATGCGGA
>probe:Drosophila_2:1636055_at:279:235; Interrogation_Position=1676; Antisense; AATGCCAAGGACAACAGCACCGGGA
>probe:Drosophila_2:1636055_at:726:271; Interrogation_Position=1717; Antisense; CATTTCCAACGACAAGGGCAGACTT
>probe:Drosophila_2:1636055_at:727:559; Interrogation_Position=1750; Antisense; GGAAATCGATCGCATGCTCTCGGAG
>probe:Drosophila_2:1636055_at:172:665; Interrogation_Position=1784; Antisense; TACAAGGTCGAGGACGATCGTCAGA
>probe:Drosophila_2:1636055_at:670:553; Interrogation_Position=1810; Antisense; GGAGCGGGTTCAGTCCAAGAACAAT
>probe:Drosophila_2:1636055_at:532:387; Interrogation_Position=1828; Antisense; GAACAATCTCGAGGCATACATCTAC
>probe:Drosophila_2:1636055_at:573:47; Interrogation_Position=1942; Antisense; ATCCTGGCTGGACAAGAACTCGCTG
>probe:Drosophila_2:1636055_at:516:89; Interrogation_Position=1988; Antisense; AGTCACCTGAAAGAGTGCCAGCGCA
>probe:Drosophila_2:1636055_at:636:261; Interrogation_Position=2006; Antisense; CAGCGCATCTGTACTCCAATAATGT
>probe:Drosophila_2:1636055_at:558:653; Interrogation_Position=2025; Antisense; TAATGTCGAAAATCCATGGCGGCAA
>probe:Drosophila_2:1636055_at:11:257; Interrogation_Position=2056; Antisense; CAAATCATCGATGGGCAAGGGTTCC
>probe:Drosophila_2:1636055_at:635:221; Interrogation_Position=2072; Antisense; AAGGGTTCCCATCCCACTGTGGAGG
>probe:Drosophila_2:1636055_at:597:487; Interrogation_Position=2110; Antisense; GTACGATCCACCGACCTAAATTATT

Paste this into a BLAST search page for me
AGGTGGCCTTCGACTTGAATGCGGAAATGCCAAGGACAACAGCACCGGGACATTTCCAACGACAAGGGCAGACTTGGAAATCGATCGCATGCTCTCGGAGTACAAGGTCGAGGACGATCGTCAGAGGAGCGGGTTCAGTCCAAGAACAATGAACAATCTCGAGGCATACATCTACATCCTGGCTGGACAAGAACTCGCTGAGTCACCTGAAAGAGTGCCAGCGCACAGCGCATCTGTACTCCAATAATGTTAATGTCGAAAATCCATGGCGGCAACAAATCATCGATGGGCAAGGGTTCCAAGGGTTCCCATCCCACTGTGGAGGGTACGATCCACCGACCTAAATTATT

Full Affymetrix probeset data:

Annotations for 1636055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720