FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636056_at:

>probe:Drosophila_2:1636056_at:619:717; Interrogation_Position=219; Antisense; TTCCTGCGCCAACTGAAGAAGTTCA
>probe:Drosophila_2:1636056_at:459:373; Interrogation_Position=236; Antisense; GAAGTTCAAGAAGACCACCGGCGAG
>probe:Drosophila_2:1636056_at:634:451; Interrogation_Position=260; Antisense; GATCGTGTCCATCAAGCAGGTGTAC
>probe:Drosophila_2:1636056_at:116:515; Interrogation_Position=279; Antisense; GTGTACGAGACGTCGCCCGTGAAGA
>probe:Drosophila_2:1636056_at:581:107; Interrogation_Position=307; Antisense; AGAACTTCGGCATCTGGCTGCGTTA
>probe:Drosophila_2:1636056_at:623:87; Interrogation_Position=367; Antisense; AGTACCGTGACCTGACTGTCGGCGG
>probe:Drosophila_2:1636056_at:377:259; Interrogation_Position=398; Antisense; CACTCAGTGCTACCGCGACATGGGA
>probe:Drosophila_2:1636056_at:391:11; Interrogation_Position=459; Antisense; ATTAAGGTGGACTCGATCCCTGCCG
>probe:Drosophila_2:1636056_at:155:355; Interrogation_Position=500; Antisense; GCACGTGAAGCAGTTCCACGATTCA
>probe:Drosophila_2:1636056_at:149:171; Interrogation_Position=524; Antisense; AAAGATCAAGTTCCCTCTGGTCCAG
>probe:Drosophila_2:1636056_at:86:123; Interrogation_Position=547; Antisense; AGCGTGTCCACCACAAGGGCAACAG
>probe:Drosophila_2:1636056_at:713:173; Interrogation_Position=573; Antisense; AAACTGTTCTCGTTCAGGAAGCCCA
>probe:Drosophila_2:1636056_at:508:667; Interrogation_Position=603; Antisense; TACTTCCAGTAGGATTCTCCTGCAT
>probe:Drosophila_2:1636056_at:198:631; Interrogation_Position=620; Antisense; TCCTGCATCCTATACCTATGACTTA

Paste this into a BLAST search page for me
TTCCTGCGCCAACTGAAGAAGTTCAGAAGTTCAAGAAGACCACCGGCGAGGATCGTGTCCATCAAGCAGGTGTACGTGTACGAGACGTCGCCCGTGAAGAAGAACTTCGGCATCTGGCTGCGTTAAGTACCGTGACCTGACTGTCGGCGGCACTCAGTGCTACCGCGACATGGGAATTAAGGTGGACTCGATCCCTGCCGGCACGTGAAGCAGTTCCACGATTCAAAAGATCAAGTTCCCTCTGGTCCAGAGCGTGTCCACCACAAGGGCAACAGAAACTGTTCTCGTTCAGGAAGCCCATACTTCCAGTAGGATTCTCCTGCATTCCTGCATCCTATACCTATGACTTA

Full Affymetrix probeset data:

Annotations for 1636056_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720