FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636057_at:

>probe:Drosophila_2:1636057_at:126:337; Interrogation_Position=1102; Antisense; GCTGCCGTCCCTTCACCAAGGAGGA
>probe:Drosophila_2:1636057_at:110:227; Interrogation_Position=1118; Antisense; CAAGGAGGACCTTTGCGACCCCAAT
>probe:Drosophila_2:1636057_at:285:533; Interrogation_Position=1257; Antisense; GGTGAGTGCCTGAGCAACAACGAGT
>probe:Drosophila_2:1636057_at:321:609; Interrogation_Position=1267; Antisense; TGAGCAACAACGAGTGCCCCGACCA
>probe:Drosophila_2:1636057_at:109:347; Interrogation_Position=1300; Antisense; GCATCAACTACCAGTGCATCGATCC
>probe:Drosophila_2:1636057_at:280:43; Interrogation_Position=1317; Antisense; ATCGATCCCTGCATCGGCAAGTGTG
>probe:Drosophila_2:1636057_at:20:285; Interrogation_Position=1325; Antisense; CTGCATCGGCAAGTGTGCCACTGGA
>probe:Drosophila_2:1636057_at:621:141; Interrogation_Position=1344; Antisense; ACTGGAGCCAGCTGCGAGCCCAAGG
>probe:Drosophila_2:1636057_at:557:333; Interrogation_Position=1377; Antisense; GCTGTCTGCCGCTGTCCACAGGGAC
>probe:Drosophila_2:1636057_at:477:249; Interrogation_Position=869; Antisense; CAATCACCGGGCTGTCTGCGAGTGC
>probe:Drosophila_2:1636057_at:556:333; Interrogation_Position=879; Antisense; GCTGTCTGCGAGTGCCCCAAGGGCT
>probe:Drosophila_2:1636057_at:170:223; Interrogation_Position=897; Antisense; AAGGGCTACATTGGCAGCCCGTACA
>probe:Drosophila_2:1636057_at:601:259; Interrogation_Position=920; Antisense; CACGGAGTGCCGACCGGAGTGCTAT
>probe:Drosophila_2:1636057_at:60:301; Interrogation_Position=974; Antisense; CGCCTGCTTCTACGGCATCTGCAAG

Paste this into a BLAST search page for me
GCTGCCGTCCCTTCACCAAGGAGGACAAGGAGGACCTTTGCGACCCCAATGGTGAGTGCCTGAGCAACAACGAGTTGAGCAACAACGAGTGCCCCGACCAGCATCAACTACCAGTGCATCGATCCATCGATCCCTGCATCGGCAAGTGTGCTGCATCGGCAAGTGTGCCACTGGAACTGGAGCCAGCTGCGAGCCCAAGGGCTGTCTGCCGCTGTCCACAGGGACCAATCACCGGGCTGTCTGCGAGTGCGCTGTCTGCGAGTGCCCCAAGGGCTAAGGGCTACATTGGCAGCCCGTACACACGGAGTGCCGACCGGAGTGCTATCGCCTGCTTCTACGGCATCTGCAAG

Full Affymetrix probeset data:

Annotations for 1636057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720