FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636058_at:

>probe:Drosophila_2:1636058_at:163:257; Interrogation_Position=504; Antisense; CACTACAACTTGTACCCCAACTACG
>probe:Drosophila_2:1636058_at:482:147; Interrogation_Position=592; Antisense; ACTACAACAACTTGTGACCCCAACA
>probe:Drosophila_2:1636058_at:594:665; Interrogation_Position=594; Antisense; TACAACAACTTGTGACCCCAACAAC
>probe:Drosophila_2:1636058_at:157:397; Interrogation_Position=733; Antisense; GACAACTACTTGTACCCCAACAACG
>probe:Drosophila_2:1636058_at:686:201; Interrogation_Position=919; Antisense; AACCTGTGCCCCAACAACATCGAGC
>probe:Drosophila_2:1636058_at:714:355; Interrogation_Position=957; Antisense; GCACAACAACAACATGTACCTCAAA
>probe:Drosophila_2:1636058_at:401:189; Interrogation_Position=967; Antisense; AACATGTACCTCAAAAACGATCTCG
>probe:Drosophila_2:1636058_at:242:57; Interrogation_Position=970; Antisense; ATGTACCTCAAAAACGATCTCGACC
>probe:Drosophila_2:1636058_at:540:127; Interrogation_Position=974; Antisense; ACCTCAAAAACGATCTCGACCACTA
>probe:Drosophila_2:1636058_at:66:183; Interrogation_Position=980; Antisense; AAAACGATCTCGACCACTACATGTC
>probe:Drosophila_2:1636058_at:539:451; Interrogation_Position=985; Antisense; GATCTCGACCACTACATGTCCAGAA
>probe:Drosophila_2:1636058_at:349:643; Interrogation_Position=987; Antisense; TCTCGACCACTACATGTCCAGAAAC
>probe:Drosophila_2:1636058_at:179:411; Interrogation_Position=991; Antisense; GACCACTACATGTCCAGAAACCGCT
>probe:Drosophila_2:1636058_at:195:153; Interrogation_Position=998; Antisense; ACATGTCCAGAAACCGCTCCGACAA

Paste this into a BLAST search page for me
CACTACAACTTGTACCCCAACTACGACTACAACAACTTGTGACCCCAACATACAACAACTTGTGACCCCAACAACGACAACTACTTGTACCCCAACAACGAACCTGTGCCCCAACAACATCGAGCGCACAACAACAACATGTACCTCAAAAACATGTACCTCAAAAACGATCTCGATGTACCTCAAAAACGATCTCGACCACCTCAAAAACGATCTCGACCACTAAAAACGATCTCGACCACTACATGTCGATCTCGACCACTACATGTCCAGAATCTCGACCACTACATGTCCAGAAACGACCACTACATGTCCAGAAACCGCTACATGTCCAGAAACCGCTCCGACAA

Full Affymetrix probeset data:

Annotations for 1636058_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720