FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636059_at:

>probe:Drosophila_2:1636059_at:270:31; Interrogation_Position=341; Antisense; ATAAACTGGTCAATGTGCTCGCCTC
>probe:Drosophila_2:1636059_at:58:63; Interrogation_Position=353; Antisense; ATGTGCTCGCCTCACCGGTTAAATT
>probe:Drosophila_2:1636059_at:112:571; Interrogation_Position=459; Antisense; GGCTTCGAGTTCCTCCAAAAACGAT
>probe:Drosophila_2:1636059_at:264:77; Interrogation_Position=488; Antisense; AGGAGGAACTAACCACTTCTGCGCC
>probe:Drosophila_2:1636059_at:561:471; Interrogation_Position=517; Antisense; GTTCACTTGGACTGGCTGGAGGATC
>probe:Drosophila_2:1636059_at:9:59; Interrogation_Position=548; Antisense; ATGAGGTGGACTACATTCCAGAGAA
>probe:Drosophila_2:1636059_at:404:245; Interrogation_Position=630; Antisense; AATTATGTTGCTCTTTATTCGATGA
>probe:Drosophila_2:1636059_at:587:9; Interrogation_Position=646; Antisense; ATTCGATGAGCCTTTCCTATTTATG
>probe:Drosophila_2:1636059_at:98:489; Interrogation_Position=736; Antisense; GTACGAACTCGTTTGCTGATTCATC
>probe:Drosophila_2:1636059_at:98:335; Interrogation_Position=750; Antisense; GCTGATTCATCATTGCAACTGGTAT
>probe:Drosophila_2:1636059_at:3:429; Interrogation_Position=830; Antisense; GTGTTTGTAGTTCAAGTCCGGTGTT
>probe:Drosophila_2:1636059_at:111:365; Interrogation_Position=870; Antisense; GAATTTAGCATAACTGGAACCCAAA
>probe:Drosophila_2:1636059_at:697:583; Interrogation_Position=884; Antisense; TGGAACCCAAAAACTTGTTGTGACT
>probe:Drosophila_2:1636059_at:367:597; Interrogation_Position=902; Antisense; TGTGACTACAGAGCCAATTGGGTTT

Paste this into a BLAST search page for me
ATAAACTGGTCAATGTGCTCGCCTCATGTGCTCGCCTCACCGGTTAAATTGGCTTCGAGTTCCTCCAAAAACGATAGGAGGAACTAACCACTTCTGCGCCGTTCACTTGGACTGGCTGGAGGATCATGAGGTGGACTACATTCCAGAGAAAATTATGTTGCTCTTTATTCGATGAATTCGATGAGCCTTTCCTATTTATGGTACGAACTCGTTTGCTGATTCATCGCTGATTCATCATTGCAACTGGTATGTGTTTGTAGTTCAAGTCCGGTGTTGAATTTAGCATAACTGGAACCCAAATGGAACCCAAAAACTTGTTGTGACTTGTGACTACAGAGCCAATTGGGTTT

Full Affymetrix probeset data:

Annotations for 1636059_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720