FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636062_at:

>probe:Drosophila_2:1636062_at:686:111; Interrogation_Position=616; Antisense; AGCAAGCCATACGACAAGCTGTCCA
>probe:Drosophila_2:1636062_at:443:207; Interrogation_Position=631; Antisense; AAGCTGTCCACTTCCATGTCATCAT
>probe:Drosophila_2:1636062_at:108:421; Interrogation_Position=675; Antisense; GAGCAGTTCATCGTCCGCGGGATTC
>probe:Drosophila_2:1636062_at:316:543; Interrogation_Position=694; Antisense; GGATTCGGTGGCGAAGTCCTCAAAA
>probe:Drosophila_2:1636062_at:527:181; Interrogation_Position=715; Antisense; AAAAAACGGCGACTGGCCGCCAATG
>probe:Drosophila_2:1636062_at:483:385; Interrogation_Position=759; Antisense; GAACAGCCTGAACGATGCCTTCGAC
>probe:Drosophila_2:1636062_at:611:101; Interrogation_Position=790; Antisense; AGAGATGTGGTTCCATCACTCGGCC
>probe:Drosophila_2:1636062_at:621:451; Interrogation_Position=817; Antisense; GATCGGCGACTCTCCAAATACGAAA
>probe:Drosophila_2:1636062_at:158:391; Interrogation_Position=838; Antisense; GAAACTCTGCAAATGGCGCAAGCAT
>probe:Drosophila_2:1636062_at:278:591; Interrogation_Position=875; Antisense; TGGTCACGTTGCTGTCCAGAGACTA
>probe:Drosophila_2:1636062_at:248:85; Interrogation_Position=906; Antisense; AGTGTGGGCGATCCTTTATCCTTTC
>probe:Drosophila_2:1636062_at:319:227; Interrogation_Position=938; Antisense; AATGGAAGTTCCTTTTGCGGGCTGT
>probe:Drosophila_2:1636062_at:9:693; Interrogation_Position=951; Antisense; TTTGCGGGCTGTGTTGCAGCAACAC
>probe:Drosophila_2:1636062_at:6:265; Interrogation_Position=967; Antisense; CAGCAACACCTTCATATCCTAGTGG

Paste this into a BLAST search page for me
AGCAAGCCATACGACAAGCTGTCCAAAGCTGTCCACTTCCATGTCATCATGAGCAGTTCATCGTCCGCGGGATTCGGATTCGGTGGCGAAGTCCTCAAAAAAAAAACGGCGACTGGCCGCCAATGGAACAGCCTGAACGATGCCTTCGACAGAGATGTGGTTCCATCACTCGGCCGATCGGCGACTCTCCAAATACGAAAGAAACTCTGCAAATGGCGCAAGCATTGGTCACGTTGCTGTCCAGAGACTAAGTGTGGGCGATCCTTTATCCTTTCAATGGAAGTTCCTTTTGCGGGCTGTTTTGCGGGCTGTGTTGCAGCAACACCAGCAACACCTTCATATCCTAGTGG

Full Affymetrix probeset data:

Annotations for 1636062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720