FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636063_at:

>probe:Drosophila_2:1636063_at:5:567; Interrogation_Position=1192; Antisense; GGCATTGCCTGGTATGTGAACGATC
>probe:Drosophila_2:1636063_at:59:511; Interrogation_Position=1207; Antisense; GTGAACGATCTGCTGATCCCTGAAA
>probe:Drosophila_2:1636063_at:19:241; Interrogation_Position=1230; Antisense; AATCACTGTGGAACGTGGCCTGACC
>probe:Drosophila_2:1636063_at:32:581; Interrogation_Position=1245; Antisense; TGGCCTGACCTACGAGTTCATAATC
>probe:Drosophila_2:1636063_at:188:525; Interrogation_Position=1272; Antisense; GGGCGGCAATGATCCTAGTCAACCA
>probe:Drosophila_2:1636063_at:56:89; Interrogation_Position=1288; Antisense; AGTCAACCAGCTAGATATCATCCGT
>probe:Drosophila_2:1636063_at:379:227; Interrogation_Position=1378; Antisense; AAGGCCTATGCTGGCGTAGAATACG
>probe:Drosophila_2:1636063_at:169:407; Interrogation_Position=1408; Antisense; GACGGCAATGCTATTCCAACAGGAG
>probe:Drosophila_2:1636063_at:277:529; Interrogation_Position=1451; Antisense; GGGAGCACCAGACCATTGATCGATC
>probe:Drosophila_2:1636063_at:170:167; Interrogation_Position=1569; Antisense; AAATGCTCCCGATCAGCTTTACTAT
>probe:Drosophila_2:1636063_at:10:343; Interrogation_Position=1598; Antisense; GCTTTACACATAACAATCTCGGCTG
>probe:Drosophila_2:1636063_at:706:227; Interrogation_Position=1630; Antisense; AATGTCGTGGACATGGGCTCCTCCG
>probe:Drosophila_2:1636063_at:125:497; Interrogation_Position=1666; Antisense; GTCAGCAGTCACCAGTTTAGTTTTT
>probe:Drosophila_2:1636063_at:482:91; Interrogation_Position=1704; Antisense; AGTATTTAGCCTGGTCGCGACAAGC

Paste this into a BLAST search page for me
GGCATTGCCTGGTATGTGAACGATCGTGAACGATCTGCTGATCCCTGAAAAATCACTGTGGAACGTGGCCTGACCTGGCCTGACCTACGAGTTCATAATCGGGCGGCAATGATCCTAGTCAACCAAGTCAACCAGCTAGATATCATCCGTAAGGCCTATGCTGGCGTAGAATACGGACGGCAATGCTATTCCAACAGGAGGGGAGCACCAGACCATTGATCGATCAAATGCTCCCGATCAGCTTTACTATGCTTTACACATAACAATCTCGGCTGAATGTCGTGGACATGGGCTCCTCCGGTCAGCAGTCACCAGTTTAGTTTTTAGTATTTAGCCTGGTCGCGACAAGC

Full Affymetrix probeset data:

Annotations for 1636063_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720