FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636067_at:

>probe:Drosophila_2:1636067_at:597:233; Interrogation_Position=232; Antisense; AATGCCCAGTGGGAGGTCCATGGAC
>probe:Drosophila_2:1636067_at:293:79; Interrogation_Position=245; Antisense; AGGTCCATGGACTCGTTGCGTTCAT
>probe:Drosophila_2:1636067_at:1:97; Interrogation_Position=295; Antisense; AGATTCATCGCACAATTCGCTGGAG
>probe:Drosophila_2:1636067_at:201:199; Interrogation_Position=411; Antisense; AACGCGTCGATTCCGTCAAGGAGGA
>probe:Drosophila_2:1636067_at:352:387; Interrogation_Position=434; Antisense; GAAAATCTGAAGCTGCGCTCCGAGA
>probe:Drosophila_2:1636067_at:660:267; Interrogation_Position=461; Antisense; CAGGTGCTCGGCCAGTACATCGAGA
>probe:Drosophila_2:1636067_at:475:43; Interrogation_Position=479; Antisense; ATCGAGAACCTGATGTCGGCCTCAT
>probe:Drosophila_2:1636067_at:667:493; Interrogation_Position=544; Antisense; GTAATCTTCTATAGTCAATCGACCC
>probe:Drosophila_2:1636067_at:41:655; Interrogation_Position=558; Antisense; TCAATCGACCCACCGGTACTGGAAA
>probe:Drosophila_2:1636067_at:330:175; Interrogation_Position=587; Antisense; AAACCTTCTCAAATATGCCTTCTCG
>probe:Drosophila_2:1636067_at:646:715; Interrogation_Position=606; Antisense; TTCTCGTTCACGCTAGAGCTACATG
>probe:Drosophila_2:1636067_at:596:59; Interrogation_Position=670; Antisense; ATGTTATTTCAGTTGCCCGATTGTC
>probe:Drosophila_2:1636067_at:198:321; Interrogation_Position=684; Antisense; GCCCGATTGTCGAATTTGTATTTGT
>probe:Drosophila_2:1636067_at:641:679; Interrogation_Position=710; Antisense; TAGGCTTAAGCTTATGGCGCGCTAT

Paste this into a BLAST search page for me
AATGCCCAGTGGGAGGTCCATGGACAGGTCCATGGACTCGTTGCGTTCATAGATTCATCGCACAATTCGCTGGAGAACGCGTCGATTCCGTCAAGGAGGAGAAAATCTGAAGCTGCGCTCCGAGACAGGTGCTCGGCCAGTACATCGAGAATCGAGAACCTGATGTCGGCCTCATGTAATCTTCTATAGTCAATCGACCCTCAATCGACCCACCGGTACTGGAAAAAACCTTCTCAAATATGCCTTCTCGTTCTCGTTCACGCTAGAGCTACATGATGTTATTTCAGTTGCCCGATTGTCGCCCGATTGTCGAATTTGTATTTGTTAGGCTTAAGCTTATGGCGCGCTAT

Full Affymetrix probeset data:

Annotations for 1636067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720