Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636070_at:

>probe:Drosophila_2:1636070_at:632:583; Interrogation_Position=123; Antisense; TGGCATATACGCCACACACAGCGGA
>probe:Drosophila_2:1636070_at:451:53; Interrogation_Position=13; Antisense; ATGAGCGAAATAAACGTGTTCCGTT
>probe:Drosophila_2:1636070_at:99:537; Interrogation_Position=181; Antisense; GGTCGCAGGACTCCGCTTGCAGCTA
>probe:Drosophila_2:1636070_at:682:463; Interrogation_Position=215; Antisense; GATTCCCAGACTTATCCGAGTCCTG
>probe:Drosophila_2:1636070_at:317:47; Interrogation_Position=228; Antisense; ATCCGAGTCCTGGTGTTGTCATGGC
>probe:Drosophila_2:1636070_at:99:605; Interrogation_Position=241; Antisense; TGTTGTCATGGCTGCTGCTGTCGTT
>probe:Drosophila_2:1636070_at:544:335; Interrogation_Position=254; Antisense; GCTGCTGTCGTTTGTTGGCCACTAA
>probe:Drosophila_2:1636070_at:55:725; Interrogation_Position=268; Antisense; TTGGCCACTAACGAGGCGAGTAAAG
>probe:Drosophila_2:1636070_at:574:599; Interrogation_Position=29; Antisense; TGTTCCGTTGTCGTTTCATCCAGGT
>probe:Drosophila_2:1636070_at:321:395; Interrogation_Position=311; Antisense; GAAATGCTTCATTGCGCGCTACAAA
>probe:Drosophila_2:1636070_at:52:341; Interrogation_Position=328; Antisense; GCTACAAATTACAGCGCCACAGTTG
>probe:Drosophila_2:1636070_at:486:47; Interrogation_Position=46; Antisense; ATCCAGGTCCTGGTTCCTTGTGCTC
>probe:Drosophila_2:1636070_at:100:709; Interrogation_Position=77; Antisense; TTGGCTTCTTGGACCGACAGCTTAA
>probe:Drosophila_2:1636070_at:663:411; Interrogation_Position=88; Antisense; GACCGACAGCTTAACGAGCTGCTCA

Paste this into a BLAST search page for me
TGGCATATACGCCACACACAGCGGAATGAGCGAAATAAACGTGTTCCGTTGGTCGCAGGACTCCGCTTGCAGCTAGATTCCCAGACTTATCCGAGTCCTGATCCGAGTCCTGGTGTTGTCATGGCTGTTGTCATGGCTGCTGCTGTCGTTGCTGCTGTCGTTTGTTGGCCACTAATTGGCCACTAACGAGGCGAGTAAAGTGTTCCGTTGTCGTTTCATCCAGGTGAAATGCTTCATTGCGCGCTACAAAGCTACAAATTACAGCGCCACAGTTGATCCAGGTCCTGGTTCCTTGTGCTCTTGGCTTCTTGGACCGACAGCTTAAGACCGACAGCTTAACGAGCTGCTCA

Full Affymetrix probeset data:

Annotations for 1636070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime