Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636073_at:

>probe:Drosophila_2:1636073_at:509:229; Interrogation_Position=2132; Antisense; AATGGTCTCTGTACAAGATCCGCGA
>probe:Drosophila_2:1636073_at:376:413; Interrogation_Position=2155; Antisense; GAGCCAACAAAATTCGGACCGAGTC
>probe:Drosophila_2:1636073_at:204:411; Interrogation_Position=2171; Antisense; GACCGAGTCCGGTGCGTGGATTCCT
>probe:Drosophila_2:1636073_at:712:587; Interrogation_Position=2187; Antisense; TGGATTCCTGCCTCCTTTAAAACAG
>probe:Drosophila_2:1636073_at:448:289; Interrogation_Position=2285; Antisense; CGAAAACGCCAAGCCGTTGAGCCAT
>probe:Drosophila_2:1636073_at:102:267; Interrogation_Position=2323; Antisense; CAGTCAGTCGTCATGCGCGGCACAA
>probe:Drosophila_2:1636073_at:437:51; Interrogation_Position=2335; Antisense; ATGCGCGGCACAACTTAAAGCTAGA
>probe:Drosophila_2:1636073_at:211:107; Interrogation_Position=2365; Antisense; AGAAGCGACTGACCGGAAACGACAA
>probe:Drosophila_2:1636073_at:527:357; Interrogation_Position=2408; Antisense; GCAAATTGTCAAGTCTCGCATGCGA
>probe:Drosophila_2:1636073_at:530:643; Interrogation_Position=2421; Antisense; TCTCGCATGCGACTGGAGTTCATTA
>probe:Drosophila_2:1636073_at:330:701; Interrogation_Position=2563; Antisense; TTTTACGCAGAAGCATTGGGACCGA
>probe:Drosophila_2:1636073_at:128:413; Interrogation_Position=2582; Antisense; GACCGACGTTCAGCGCATGGGTAAT
>probe:Drosophila_2:1636073_at:272:231; Interrogation_Position=2604; Antisense; AATGTTCTGACAAATCGCCTTCCTC
>probe:Drosophila_2:1636073_at:686:187; Interrogation_Position=2635; Antisense; AACACTCCCCATATTTGTTTACTGG

Paste this into a BLAST search page for me
AATGGTCTCTGTACAAGATCCGCGAGAGCCAACAAAATTCGGACCGAGTCGACCGAGTCCGGTGCGTGGATTCCTTGGATTCCTGCCTCCTTTAAAACAGCGAAAACGCCAAGCCGTTGAGCCATCAGTCAGTCGTCATGCGCGGCACAAATGCGCGGCACAACTTAAAGCTAGAAGAAGCGACTGACCGGAAACGACAAGCAAATTGTCAAGTCTCGCATGCGATCTCGCATGCGACTGGAGTTCATTATTTTACGCAGAAGCATTGGGACCGAGACCGACGTTCAGCGCATGGGTAATAATGTTCTGACAAATCGCCTTCCTCAACACTCCCCATATTTGTTTACTGG

Full Affymetrix probeset data:

Annotations for 1636073_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime