FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636074_at:

>probe:Drosophila_2:1636074_at:201:331; Interrogation_Position=1265; Antisense; GCGGACAATTTCACCAGCAAGACTT
>probe:Drosophila_2:1636074_at:157:253; Interrogation_Position=1282; Antisense; CAAGACTTGGGCTCGAGCTGCGTTG
>probe:Drosophila_2:1636074_at:3:285; Interrogation_Position=1299; Antisense; CTGCGTTGTGTTGCGGAGATCGATC
>probe:Drosophila_2:1636074_at:54:295; Interrogation_Position=1319; Antisense; CGATCGGTATCCTCATCTGCAAAGA
>probe:Drosophila_2:1636074_at:26:423; Interrogation_Position=1342; Antisense; GAGAAGGCACTATGTTCGCCCAGCT
>probe:Drosophila_2:1636074_at:389:263; Interrogation_Position=1362; Antisense; CAGCTCTTCAGGGACGATATCGATC
>probe:Drosophila_2:1636074_at:617:453; Interrogation_Position=1403; Antisense; GATCAACTCGAGATCGGGTGCCACT
>probe:Drosophila_2:1636074_at:669:531; Interrogation_Position=1418; Antisense; GGGTGCCACTCCAAATTCACAAGTG
>probe:Drosophila_2:1636074_at:672:335; Interrogation_Position=1451; Antisense; GCTGCTGGTGGCTATTTCGATGACG
>probe:Drosophila_2:1636074_at:151:295; Interrogation_Position=1468; Antisense; CGATGACGATGACCGCAGTGCGACT
>probe:Drosophila_2:1636074_at:399:645; Interrogation_Position=1492; Antisense; TCTTCACACCGCTGACATTTCAATA
>probe:Drosophila_2:1636074_at:197:537; Interrogation_Position=1547; Antisense; GGCGGCGACGTAATGTAGTTTTCCT
>probe:Drosophila_2:1636074_at:7:637; Interrogation_Position=1571; Antisense; TCGTTTCCGGTTTTGATTGCGTTAT
>probe:Drosophila_2:1636074_at:684:621; Interrogation_Position=1588; Antisense; TGCGTTATTTTTTGTTCGGTTCGAT

Paste this into a BLAST search page for me
GCGGACAATTTCACCAGCAAGACTTCAAGACTTGGGCTCGAGCTGCGTTGCTGCGTTGTGTTGCGGAGATCGATCCGATCGGTATCCTCATCTGCAAAGAGAGAAGGCACTATGTTCGCCCAGCTCAGCTCTTCAGGGACGATATCGATCGATCAACTCGAGATCGGGTGCCACTGGGTGCCACTCCAAATTCACAAGTGGCTGCTGGTGGCTATTTCGATGACGCGATGACGATGACCGCAGTGCGACTTCTTCACACCGCTGACATTTCAATAGGCGGCGACGTAATGTAGTTTTCCTTCGTTTCCGGTTTTGATTGCGTTATTGCGTTATTTTTTGTTCGGTTCGAT

Full Affymetrix probeset data:

Annotations for 1636074_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720