FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636075_at:

>probe:Drosophila_2:1636075_at:463:289; Interrogation_Position=1014; Antisense; CGGCATTTCCGCTATCCGAGAAATA
>probe:Drosophila_2:1636075_at:225:159; Interrogation_Position=1040; Antisense; ACAAGGGCATGCTGGCTGAACTAAT
>probe:Drosophila_2:1636075_at:616:471; Interrogation_Position=1075; Antisense; GTTCTGCAGCGCGAAGTTCTGGAGT
>probe:Drosophila_2:1636075_at:170:135; Interrogation_Position=1106; Antisense; ACGCCGAGGAAGGTTTGCTGACGCA
>probe:Drosophila_2:1636075_at:180:123; Interrogation_Position=1144; Antisense; AGCGTTGGGCTAAGTGGCCGCACAT
>probe:Drosophila_2:1636075_at:502:351; Interrogation_Position=1208; Antisense; GCAGCACTCTGTTCGAGTTGGACCA
>probe:Drosophila_2:1636075_at:706:647; Interrogation_Position=1238; Antisense; TCAGTCTATCGGACTTTCTGGACGC
>probe:Drosophila_2:1636075_at:680:69; Interrogation_Position=1271; Antisense; AGGCCCTGGAGCAGCATTTAGGCGA
>probe:Drosophila_2:1636075_at:161:47; Interrogation_Position=1438; Antisense; ATCCGATGCAGAGGCACGGGTCCAA
>probe:Drosophila_2:1636075_at:74:517; Interrogation_Position=874; Antisense; GTGGTAAATGCGGTACTCACCCAGC
>probe:Drosophila_2:1636075_at:638:261; Interrogation_Position=895; Antisense; CAGCTGGATTCCCTTAAGACTTGTC
>probe:Drosophila_2:1636075_at:387:657; Interrogation_Position=909; Antisense; TAAGACTTGTCCCAACGTACTGATC
>probe:Drosophila_2:1636075_at:271:255; Interrogation_Position=955; Antisense; CAAAGCATTGATCTGGCCTTCGTGG
>probe:Drosophila_2:1636075_at:319:23; Interrogation_Position=989; Antisense; ATATCCGACTCTTCATTGGTTATCC

Paste this into a BLAST search page for me
CGGCATTTCCGCTATCCGAGAAATAACAAGGGCATGCTGGCTGAACTAATGTTCTGCAGCGCGAAGTTCTGGAGTACGCCGAGGAAGGTTTGCTGACGCAAGCGTTGGGCTAAGTGGCCGCACATGCAGCACTCTGTTCGAGTTGGACCATCAGTCTATCGGACTTTCTGGACGCAGGCCCTGGAGCAGCATTTAGGCGAATCCGATGCAGAGGCACGGGTCCAAGTGGTAAATGCGGTACTCACCCAGCCAGCTGGATTCCCTTAAGACTTGTCTAAGACTTGTCCCAACGTACTGATCCAAAGCATTGATCTGGCCTTCGTGGATATCCGACTCTTCATTGGTTATCC

Full Affymetrix probeset data:

Annotations for 1636075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720